ID: 910497437

View in Genome Browser
Species Human (GRCh38)
Location 1:87847716-87847738
Sequence AGGAATGGACCACTGCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910497433_910497437 -1 Left 910497433 1:87847694-87847716 CCAAGTGTTCATGAGCATGTAAA No data
Right 910497437 1:87847716-87847738 AGGAATGGACCACTGCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910497437 Original CRISPR AGGAATGGACCACTGCTGAT GGG Intergenic
No off target data available for this crispr