ID: 910498521

View in Genome Browser
Species Human (GRCh38)
Location 1:87861380-87861402
Sequence GCTACTATGTTAACTGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910498521_910498522 -10 Left 910498521 1:87861380-87861402 CCAGTTGCAGTTAACATAGTAGC No data
Right 910498522 1:87861393-87861415 ACATAGTAGCGTGCAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910498521 Original CRISPR GCTACTATGTTAACTGCAAC TGG (reversed) Intergenic
No off target data available for this crispr