ID: 910498522

View in Genome Browser
Species Human (GRCh38)
Location 1:87861393-87861415
Sequence ACATAGTAGCGTGCAAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910498521_910498522 -10 Left 910498521 1:87861380-87861402 CCAGTTGCAGTTAACATAGTAGC No data
Right 910498522 1:87861393-87861415 ACATAGTAGCGTGCAAAGCAAGG No data
910498520_910498522 0 Left 910498520 1:87861370-87861392 CCAGTACACACCAGTTGCAGTTA No data
Right 910498522 1:87861393-87861415 ACATAGTAGCGTGCAAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910498522 Original CRISPR ACATAGTAGCGTGCAAAGCA AGG Intergenic
No off target data available for this crispr