ID: 910501768

View in Genome Browser
Species Human (GRCh38)
Location 1:87900590-87900612
Sequence ATGAAGAAGGAGAAAGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910501768_910501773 -7 Left 910501768 1:87900590-87900612 CCCATCTCTTTCTCCTTCTTCAT No data
Right 910501773 1:87900606-87900628 TCTTCATGCCTCATTTGGGCTGG No data
910501768_910501774 -6 Left 910501768 1:87900590-87900612 CCCATCTCTTTCTCCTTCTTCAT No data
Right 910501774 1:87900607-87900629 CTTCATGCCTCATTTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910501768 Original CRISPR ATGAAGAAGGAGAAAGAGAT GGG (reversed) Intergenic
No off target data available for this crispr