ID: 910501773

View in Genome Browser
Species Human (GRCh38)
Location 1:87900606-87900628
Sequence TCTTCATGCCTCATTTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910501765_910501773 30 Left 910501765 1:87900553-87900575 CCTCCGAGGCTCAGCTTCTTTTT No data
Right 910501773 1:87900606-87900628 TCTTCATGCCTCATTTGGGCTGG No data
910501767_910501773 1 Left 910501767 1:87900582-87900604 CCTTTGCTCCCATCTCTTTCTCC No data
Right 910501773 1:87900606-87900628 TCTTCATGCCTCATTTGGGCTGG No data
910501766_910501773 27 Left 910501766 1:87900556-87900578 CCGAGGCTCAGCTTCTTTTTCAA No data
Right 910501773 1:87900606-87900628 TCTTCATGCCTCATTTGGGCTGG No data
910501768_910501773 -7 Left 910501768 1:87900590-87900612 CCCATCTCTTTCTCCTTCTTCAT No data
Right 910501773 1:87900606-87900628 TCTTCATGCCTCATTTGGGCTGG No data
910501769_910501773 -8 Left 910501769 1:87900591-87900613 CCATCTCTTTCTCCTTCTTCATG No data
Right 910501773 1:87900606-87900628 TCTTCATGCCTCATTTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910501773 Original CRISPR TCTTCATGCCTCATTTGGGC TGG Intergenic
No off target data available for this crispr