ID: 910501774

View in Genome Browser
Species Human (GRCh38)
Location 1:87900607-87900629
Sequence CTTCATGCCTCATTTGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910501768_910501774 -6 Left 910501768 1:87900590-87900612 CCCATCTCTTTCTCCTTCTTCAT No data
Right 910501774 1:87900607-87900629 CTTCATGCCTCATTTGGGCTGGG No data
910501769_910501774 -7 Left 910501769 1:87900591-87900613 CCATCTCTTTCTCCTTCTTCATG No data
Right 910501774 1:87900607-87900629 CTTCATGCCTCATTTGGGCTGGG No data
910501767_910501774 2 Left 910501767 1:87900582-87900604 CCTTTGCTCCCATCTCTTTCTCC No data
Right 910501774 1:87900607-87900629 CTTCATGCCTCATTTGGGCTGGG No data
910501766_910501774 28 Left 910501766 1:87900556-87900578 CCGAGGCTCAGCTTCTTTTTCAA No data
Right 910501774 1:87900607-87900629 CTTCATGCCTCATTTGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910501774 Original CRISPR CTTCATGCCTCATTTGGGCT GGG Intergenic
No off target data available for this crispr