ID: 910502031

View in Genome Browser
Species Human (GRCh38)
Location 1:87903335-87903357
Sequence CCAGGTGAACAGAAGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910502024_910502031 16 Left 910502024 1:87903296-87903318 CCATTCTTAGGGCTTTTGTTTAG No data
Right 910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910502031 Original CRISPR CCAGGTGAACAGAAGGGAGA GGG Intergenic
No off target data available for this crispr