ID: 910505632

View in Genome Browser
Species Human (GRCh38)
Location 1:87947279-87947301
Sequence ATTTAAACACATATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910505625_910505632 13 Left 910505625 1:87947243-87947265 CCTCCCTACAACTCCAATCAAGA No data
Right 910505632 1:87947279-87947301 ATTTAAACACATATGGAAAATGG No data
910505626_910505632 10 Left 910505626 1:87947246-87947268 CCCTACAACTCCAATCAAGAGCT No data
Right 910505632 1:87947279-87947301 ATTTAAACACATATGGAAAATGG No data
910505624_910505632 16 Left 910505624 1:87947240-87947262 CCACCTCCCTACAACTCCAATCA No data
Right 910505632 1:87947279-87947301 ATTTAAACACATATGGAAAATGG No data
910505627_910505632 9 Left 910505627 1:87947247-87947269 CCTACAACTCCAATCAAGAGCTA No data
Right 910505632 1:87947279-87947301 ATTTAAACACATATGGAAAATGG No data
910505629_910505632 0 Left 910505629 1:87947256-87947278 CCAATCAAGAGCTACCATGGATA No data
Right 910505632 1:87947279-87947301 ATTTAAACACATATGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910505632 Original CRISPR ATTTAAACACATATGGAAAA TGG Intergenic
No off target data available for this crispr