ID: 910507669

View in Genome Browser
Species Human (GRCh38)
Location 1:87968613-87968635
Sequence TACAGCTGGCTCCACTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910507664_910507669 -7 Left 910507664 1:87968597-87968619 CCCACATTTCCAAAGCTACAGCT No data
Right 910507669 1:87968613-87968635 TACAGCTGGCTCCACTGGACTGG No data
910507665_910507669 -8 Left 910507665 1:87968598-87968620 CCACATTTCCAAAGCTACAGCTG No data
Right 910507669 1:87968613-87968635 TACAGCTGGCTCCACTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910507669 Original CRISPR TACAGCTGGCTCCACTGGAC TGG Intergenic
No off target data available for this crispr