ID: 910509741

View in Genome Browser
Species Human (GRCh38)
Location 1:87990543-87990565
Sequence AAACCAATACATGTCTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910509741_910509745 3 Left 910509741 1:87990543-87990565 CCATTTAAGACATGTATTGGTTT No data
Right 910509745 1:87990569-87990591 TTTACATGCTGATGGTGCAGGGG No data
910509741_910509747 23 Left 910509741 1:87990543-87990565 CCATTTAAGACATGTATTGGTTT No data
Right 910509747 1:87990589-87990611 GGGATTCCTCCCTCGCTCAAGGG No data
910509741_910509746 22 Left 910509741 1:87990543-87990565 CCATTTAAGACATGTATTGGTTT No data
Right 910509746 1:87990588-87990610 GGGGATTCCTCCCTCGCTCAAGG No data
910509741_910509742 -5 Left 910509741 1:87990543-87990565 CCATTTAAGACATGTATTGGTTT No data
Right 910509742 1:87990561-87990583 GGTTTTTCTTTACATGCTGATGG No data
910509741_910509744 2 Left 910509741 1:87990543-87990565 CCATTTAAGACATGTATTGGTTT No data
Right 910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG No data
910509741_910509743 1 Left 910509741 1:87990543-87990565 CCATTTAAGACATGTATTGGTTT No data
Right 910509743 1:87990567-87990589 TCTTTACATGCTGATGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910509741 Original CRISPR AAACCAATACATGTCTTAAA TGG (reversed) Intergenic
No off target data available for this crispr