ID: 910509744

View in Genome Browser
Species Human (GRCh38)
Location 1:87990568-87990590
Sequence CTTTACATGCTGATGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910509741_910509744 2 Left 910509741 1:87990543-87990565 CCATTTAAGACATGTATTGGTTT No data
Right 910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910509744 Original CRISPR CTTTACATGCTGATGGTGCA GGG Intergenic
No off target data available for this crispr