ID: 910513782

View in Genome Browser
Species Human (GRCh38)
Location 1:88036316-88036338
Sequence GAGGTGGCTGCACTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910513782_910513788 10 Left 910513782 1:88036316-88036338 CCCCAGCACAGTGCAGCCACCTC No data
Right 910513788 1:88036349-88036371 AGCCAGACTGTTTTTCATGTGGG No data
910513782_910513787 9 Left 910513782 1:88036316-88036338 CCCCAGCACAGTGCAGCCACCTC No data
Right 910513787 1:88036348-88036370 CAGCCAGACTGTTTTTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910513782 Original CRISPR GAGGTGGCTGCACTGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr