ID: 910514400

View in Genome Browser
Species Human (GRCh38)
Location 1:88043055-88043077
Sequence TTGGACTCCATTACAAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910514397_910514400 25 Left 910514397 1:88043007-88043029 CCCACAGTAAATTTGATAAGCTA No data
Right 910514400 1:88043055-88043077 TTGGACTCCATTACAAAAATTGG No data
910514398_910514400 24 Left 910514398 1:88043008-88043030 CCACAGTAAATTTGATAAGCTAC No data
Right 910514400 1:88043055-88043077 TTGGACTCCATTACAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910514400 Original CRISPR TTGGACTCCATTACAAAAAT TGG Intergenic
No off target data available for this crispr