ID: 910515489

View in Genome Browser
Species Human (GRCh38)
Location 1:88055094-88055116
Sequence AAGGAGAGCACCGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910515489_910515496 23 Left 910515489 1:88055094-88055116 CCCACAATCACGGTGCTCTCCTT No data
Right 910515496 1:88055140-88055162 TCCCACCATGTGGCTACTGCCGG No data
910515489_910515501 28 Left 910515489 1:88055094-88055116 CCCACAATCACGGTGCTCTCCTT No data
Right 910515501 1:88055145-88055167 CCATGTGGCTACTGCCGGATGGG No data
910515489_910515499 27 Left 910515489 1:88055094-88055116 CCCACAATCACGGTGCTCTCCTT No data
Right 910515499 1:88055144-88055166 ACCATGTGGCTACTGCCGGATGG No data
910515489_910515495 13 Left 910515489 1:88055094-88055116 CCCACAATCACGGTGCTCTCCTT No data
Right 910515495 1:88055130-88055152 GGATTCTCTCTCCCACCATGTGG No data
910515489_910515491 -8 Left 910515489 1:88055094-88055116 CCCACAATCACGGTGCTCTCCTT No data
Right 910515491 1:88055109-88055131 CTCTCCTTCCTCCAAGTACACGG No data
910515489_910515502 29 Left 910515489 1:88055094-88055116 CCCACAATCACGGTGCTCTCCTT No data
Right 910515502 1:88055146-88055168 CATGTGGCTACTGCCGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910515489 Original CRISPR AAGGAGAGCACCGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr