ID: 910519024

View in Genome Browser
Species Human (GRCh38)
Location 1:88096795-88096817
Sequence AGGTAAGGCTAGGAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910519024_910519029 -5 Left 910519024 1:88096795-88096817 CCTTCCCTCTCCTAGCCTTACCT No data
Right 910519029 1:88096813-88096835 TACCTTCCCCCAGAAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910519024 Original CRISPR AGGTAAGGCTAGGAGAGGGA AGG (reversed) Intergenic
No off target data available for this crispr