ID: 910522672

View in Genome Browser
Species Human (GRCh38)
Location 1:88140546-88140568
Sequence TTGTGTTCTACAGATGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910522669_910522672 25 Left 910522669 1:88140498-88140520 CCCAGTTTTATGTGGTGCTAGCA No data
Right 910522672 1:88140546-88140568 TTGTGTTCTACAGATGCTTCTGG No data
910522670_910522672 24 Left 910522670 1:88140499-88140521 CCAGTTTTATGTGGTGCTAGCAG No data
Right 910522672 1:88140546-88140568 TTGTGTTCTACAGATGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910522672 Original CRISPR TTGTGTTCTACAGATGCTTC TGG Intergenic
No off target data available for this crispr