ID: 910524168

View in Genome Browser
Species Human (GRCh38)
Location 1:88158227-88158249
Sequence CCGTGGTCCTATGTATTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910524168_910524173 7 Left 910524168 1:88158227-88158249 CCAGCAAATACATAGGACCACGG No data
Right 910524173 1:88158257-88158279 GTTTGTGAATTCATGGTCGCTGG No data
910524168_910524172 0 Left 910524168 1:88158227-88158249 CCAGCAAATACATAGGACCACGG No data
Right 910524172 1:88158250-88158272 ATGCATGGTTTGTGAATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910524168 Original CRISPR CCGTGGTCCTATGTATTTGC TGG (reversed) Intergenic
No off target data available for this crispr