ID: 910524552

View in Genome Browser
Species Human (GRCh38)
Location 1:88163273-88163295
Sequence TTCTGAGGTCCTTAAATAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910524552_910524557 8 Left 910524552 1:88163273-88163295 CCTCCTATTTAAGGACCTCAGAA No data
Right 910524557 1:88163304-88163326 TGCCGTTTAACAGCAGGAAAGGG No data
910524552_910524559 17 Left 910524552 1:88163273-88163295 CCTCCTATTTAAGGACCTCAGAA No data
Right 910524559 1:88163313-88163335 ACAGCAGGAAAGGGAAGAAATGG No data
910524552_910524555 2 Left 910524552 1:88163273-88163295 CCTCCTATTTAAGGACCTCAGAA No data
Right 910524555 1:88163298-88163320 TAAAATTGCCGTTTAACAGCAGG No data
910524552_910524556 7 Left 910524552 1:88163273-88163295 CCTCCTATTTAAGGACCTCAGAA No data
Right 910524556 1:88163303-88163325 TTGCCGTTTAACAGCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910524552 Original CRISPR TTCTGAGGTCCTTAAATAGG AGG (reversed) Intergenic
No off target data available for this crispr