ID: 910526284

View in Genome Browser
Species Human (GRCh38)
Location 1:88182569-88182591
Sequence AATGAGAAGCAGAATGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910526280_910526284 -5 Left 910526280 1:88182551-88182573 CCATCTATCCAAATGCCCAATGA No data
Right 910526284 1:88182569-88182591 AATGAGAAGCAGAATGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910526284 Original CRISPR AATGAGAAGCAGAATGACAA AGG Intergenic
No off target data available for this crispr