ID: 910527454

View in Genome Browser
Species Human (GRCh38)
Location 1:88197345-88197367
Sequence AGCAACTAATGCAGCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910527449_910527454 8 Left 910527449 1:88197314-88197336 CCCAGGTACTCCCTGGACTAGCT No data
Right 910527454 1:88197345-88197367 AGCAACTAATGCAGCCCAGAGGG No data
910527450_910527454 7 Left 910527450 1:88197315-88197337 CCAGGTACTCCCTGGACTAGCTC No data
Right 910527454 1:88197345-88197367 AGCAACTAATGCAGCCCAGAGGG No data
910527451_910527454 -2 Left 910527451 1:88197324-88197346 CCCTGGACTAGCTCAAAATACAG No data
Right 910527454 1:88197345-88197367 AGCAACTAATGCAGCCCAGAGGG No data
910527445_910527454 30 Left 910527445 1:88197292-88197314 CCTCTGGCAGTCCTCACTCTTTC No data
Right 910527454 1:88197345-88197367 AGCAACTAATGCAGCCCAGAGGG No data
910527447_910527454 19 Left 910527447 1:88197303-88197325 CCTCACTCTTTCCCAGGTACTCC No data
Right 910527454 1:88197345-88197367 AGCAACTAATGCAGCCCAGAGGG No data
910527452_910527454 -3 Left 910527452 1:88197325-88197347 CCTGGACTAGCTCAAAATACAGC No data
Right 910527454 1:88197345-88197367 AGCAACTAATGCAGCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910527454 Original CRISPR AGCAACTAATGCAGCCCAGA GGG Intergenic