ID: 910530046

View in Genome Browser
Species Human (GRCh38)
Location 1:88225524-88225546
Sequence AAATGGTACTAGAGGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910530046_910530050 5 Left 910530046 1:88225524-88225546 CCTTTATCCCTCTAGTACCATTT No data
Right 910530050 1:88225552-88225574 ACACCTTCTCAATCGAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910530046 Original CRISPR AAATGGTACTAGAGGGATAA AGG (reversed) Intergenic
No off target data available for this crispr