ID: 910534066

View in Genome Browser
Species Human (GRCh38)
Location 1:88276411-88276433
Sequence TTTGGTCACGTCTTCATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910534066_910534071 13 Left 910534066 1:88276411-88276433 CCATAAATGAAGACGTGACCAAA No data
Right 910534071 1:88276447-88276469 TTCTAGAAATGCAGCAACAGAGG No data
910534066_910534072 14 Left 910534066 1:88276411-88276433 CCATAAATGAAGACGTGACCAAA No data
Right 910534072 1:88276448-88276470 TCTAGAAATGCAGCAACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910534066 Original CRISPR TTTGGTCACGTCTTCATTTA TGG (reversed) Intergenic
No off target data available for this crispr