ID: 910542776

View in Genome Browser
Species Human (GRCh38)
Location 1:88379589-88379611
Sequence GGTATGAAAGATATGTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910542772_910542776 20 Left 910542772 1:88379546-88379568 CCAAGGGTGCTGGGGCTCCCTTC No data
Right 910542776 1:88379589-88379611 GGTATGAAAGATATGTCTTCTGG No data
910542773_910542776 3 Left 910542773 1:88379563-88379585 CCCTTCACACATTTATTTCTCAC No data
Right 910542776 1:88379589-88379611 GGTATGAAAGATATGTCTTCTGG No data
910542774_910542776 2 Left 910542774 1:88379564-88379586 CCTTCACACATTTATTTCTCACA No data
Right 910542776 1:88379589-88379611 GGTATGAAAGATATGTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910542776 Original CRISPR GGTATGAAAGATATGTCTTC TGG Intergenic
No off target data available for this crispr