ID: 910547143

View in Genome Browser
Species Human (GRCh38)
Location 1:88431284-88431306
Sequence TGGACATTAGAAACCCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910547143_910547145 26 Left 910547143 1:88431284-88431306 CCACTTTGGGTTTCTAATGTCCA No data
Right 910547145 1:88431333-88431355 CTTTTAAGCCATAAAGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910547143 Original CRISPR TGGACATTAGAAACCCAAAG TGG (reversed) Intergenic
No off target data available for this crispr