ID: 910549111

View in Genome Browser
Species Human (GRCh38)
Location 1:88455978-88456000
Sequence GCTGCTCTGGGGTGAGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910549111_910549118 -7 Left 910549111 1:88455978-88456000 CCCCAACCTCACCCCAGAGCAGC No data
Right 910549118 1:88455994-88456016 GAGCAGCCCTCTCCCTTGCGCGG No data
910549111_910549122 5 Left 910549111 1:88455978-88456000 CCCCAACCTCACCCCAGAGCAGC No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910549111 Original CRISPR GCTGCTCTGGGGTGAGGTTG GGG (reversed) Intergenic