ID: 910549112 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:88455979-88456001 |
Sequence | GGCTGCTCTGGGGTGAGGTT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
910549112_910549122 | 4 | Left | 910549112 | 1:88455979-88456001 | CCCAACCTCACCCCAGAGCAGCC | No data | ||
Right | 910549122 | 1:88456006-88456028 | CCCTTGCGCGGTTTTCCAAGCGG | No data | ||||
910549112_910549118 | -8 | Left | 910549112 | 1:88455979-88456001 | CCCAACCTCACCCCAGAGCAGCC | No data | ||
Right | 910549118 | 1:88455994-88456016 | GAGCAGCCCTCTCCCTTGCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
910549112 | Original CRISPR | GGCTGCTCTGGGGTGAGGTT GGG (reversed) | Intergenic | ||