ID: 910549113

View in Genome Browser
Species Human (GRCh38)
Location 1:88455980-88456002
Sequence GGGCTGCTCTGGGGTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910549113_910549126 30 Left 910549113 1:88455980-88456002 CCAACCTCACCCCAGAGCAGCCC No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549113_910549122 3 Left 910549113 1:88455980-88456002 CCAACCTCACCCCAGAGCAGCCC No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
910549113_910549118 -9 Left 910549113 1:88455980-88456002 CCAACCTCACCCCAGAGCAGCCC No data
Right 910549118 1:88455994-88456016 GAGCAGCCCTCTCCCTTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910549113 Original CRISPR GGGCTGCTCTGGGGTGAGGT TGG (reversed) Intergenic