ID: 910549114 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:88455984-88456006 |
| Sequence | GAGAGGGCTGCTCTGGGGTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 910549114_910549126 | 26 | Left | 910549114 | 1:88455984-88456006 | CCTCACCCCAGAGCAGCCCTCTC | No data | ||
| Right | 910549126 | 1:88456033-88456055 | CTGCTGCTTTCCTGCGACTTAGG | No data | ||||
| 910549114_910549122 | -1 | Left | 910549114 | 1:88455984-88456006 | CCTCACCCCAGAGCAGCCCTCTC | No data | ||
| Right | 910549122 | 1:88456006-88456028 | CCCTTGCGCGGTTTTCCAAGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910549114 | Original CRISPR | GAGAGGGCTGCTCTGGGGTG AGG (reversed) | Intergenic | ||