ID: 910549114

View in Genome Browser
Species Human (GRCh38)
Location 1:88455984-88456006
Sequence GAGAGGGCTGCTCTGGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910549114_910549126 26 Left 910549114 1:88455984-88456006 CCTCACCCCAGAGCAGCCCTCTC No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549114_910549122 -1 Left 910549114 1:88455984-88456006 CCTCACCCCAGAGCAGCCCTCTC No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910549114 Original CRISPR GAGAGGGCTGCTCTGGGGTG AGG (reversed) Intergenic