ID: 910549115

View in Genome Browser
Species Human (GRCh38)
Location 1:88455989-88456011
Sequence CAAGGGAGAGGGCTGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910549115_910549122 -6 Left 910549115 1:88455989-88456011 CCCCAGAGCAGCCCTCTCCCTTG No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
910549115_910549126 21 Left 910549115 1:88455989-88456011 CCCCAGAGCAGCCCTCTCCCTTG No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549115_910549127 26 Left 910549115 1:88455989-88456011 CCCCAGAGCAGCCCTCTCCCTTG No data
Right 910549127 1:88456038-88456060 GCTTTCCTGCGACTTAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910549115 Original CRISPR CAAGGGAGAGGGCTGCTCTG GGG (reversed) Intergenic