ID: 910549116

View in Genome Browser
Species Human (GRCh38)
Location 1:88455990-88456012
Sequence GCAAGGGAGAGGGCTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910549116_910549127 25 Left 910549116 1:88455990-88456012 CCCAGAGCAGCCCTCTCCCTTGC No data
Right 910549127 1:88456038-88456060 GCTTTCCTGCGACTTAGGACTGG No data
910549116_910549126 20 Left 910549116 1:88455990-88456012 CCCAGAGCAGCCCTCTCCCTTGC No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549116_910549122 -7 Left 910549116 1:88455990-88456012 CCCAGAGCAGCCCTCTCCCTTGC No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910549116 Original CRISPR GCAAGGGAGAGGGCTGCTCT GGG (reversed) Intergenic