ID: 910549117

View in Genome Browser
Species Human (GRCh38)
Location 1:88455991-88456013
Sequence CGCAAGGGAGAGGGCTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910549117_910549127 24 Left 910549117 1:88455991-88456013 CCAGAGCAGCCCTCTCCCTTGCG No data
Right 910549127 1:88456038-88456060 GCTTTCCTGCGACTTAGGACTGG No data
910549117_910549126 19 Left 910549117 1:88455991-88456013 CCAGAGCAGCCCTCTCCCTTGCG No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549117_910549122 -8 Left 910549117 1:88455991-88456013 CCAGAGCAGCCCTCTCCCTTGCG No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910549117 Original CRISPR CGCAAGGGAGAGGGCTGCTC TGG (reversed) Intergenic