ID: 910549122

View in Genome Browser
Species Human (GRCh38)
Location 1:88456006-88456028
Sequence CCCTTGCGCGGTTTTCCAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910549112_910549122 4 Left 910549112 1:88455979-88456001 CCCAACCTCACCCCAGAGCAGCC No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
910549114_910549122 -1 Left 910549114 1:88455984-88456006 CCTCACCCCAGAGCAGCCCTCTC No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
910549115_910549122 -6 Left 910549115 1:88455989-88456011 CCCCAGAGCAGCCCTCTCCCTTG No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
910549117_910549122 -8 Left 910549117 1:88455991-88456013 CCAGAGCAGCCCTCTCCCTTGCG No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
910549109_910549122 17 Left 910549109 1:88455966-88455988 CCTGCAAAGCACCCCCAACCTCA No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
910549113_910549122 3 Left 910549113 1:88455980-88456002 CCAACCTCACCCCAGAGCAGCCC No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
910549116_910549122 -7 Left 910549116 1:88455990-88456012 CCCAGAGCAGCCCTCTCCCTTGC No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
910549111_910549122 5 Left 910549111 1:88455978-88456000 CCCCAACCTCACCCCAGAGCAGC No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
910549110_910549122 6 Left 910549110 1:88455977-88455999 CCCCCAACCTCACCCCAGAGCAG No data
Right 910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910549122 Original CRISPR CCCTTGCGCGGTTTTCCAAG CGG Intergenic
No off target data available for this crispr