ID: 910549126

View in Genome Browser
Species Human (GRCh38)
Location 1:88456033-88456055
Sequence CTGCTGCTTTCCTGCGACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910549123_910549126 3 Left 910549123 1:88456007-88456029 CCTTGCGCGGTTTTCCAAGCGGT No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549113_910549126 30 Left 910549113 1:88455980-88456002 CCAACCTCACCCCAGAGCAGCCC No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549117_910549126 19 Left 910549117 1:88455991-88456013 CCAGAGCAGCCCTCTCCCTTGCG No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549116_910549126 20 Left 910549116 1:88455990-88456012 CCCAGAGCAGCCCTCTCCCTTGC No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549114_910549126 26 Left 910549114 1:88455984-88456006 CCTCACCCCAGAGCAGCCCTCTC No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549119_910549126 10 Left 910549119 1:88456000-88456022 CCCTCTCCCTTGCGCGGTTTTCC No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549120_910549126 9 Left 910549120 1:88456001-88456023 CCTCTCCCTTGCGCGGTTTTCCA No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549115_910549126 21 Left 910549115 1:88455989-88456011 CCCCAGAGCAGCCCTCTCCCTTG No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data
910549121_910549126 4 Left 910549121 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
Right 910549126 1:88456033-88456055 CTGCTGCTTTCCTGCGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910549126 Original CRISPR CTGCTGCTTTCCTGCGACTT AGG Intergenic