ID: 910549127

View in Genome Browser
Species Human (GRCh38)
Location 1:88456038-88456060
Sequence GCTTTCCTGCGACTTAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910549119_910549127 15 Left 910549119 1:88456000-88456022 CCCTCTCCCTTGCGCGGTTTTCC No data
Right 910549127 1:88456038-88456060 GCTTTCCTGCGACTTAGGACTGG No data
910549124_910549127 -6 Left 910549124 1:88456021-88456043 CCAAGCGGTGTCCTGCTGCTTTC No data
Right 910549127 1:88456038-88456060 GCTTTCCTGCGACTTAGGACTGG No data
910549117_910549127 24 Left 910549117 1:88455991-88456013 CCAGAGCAGCCCTCTCCCTTGCG No data
Right 910549127 1:88456038-88456060 GCTTTCCTGCGACTTAGGACTGG No data
910549116_910549127 25 Left 910549116 1:88455990-88456012 CCCAGAGCAGCCCTCTCCCTTGC No data
Right 910549127 1:88456038-88456060 GCTTTCCTGCGACTTAGGACTGG No data
910549120_910549127 14 Left 910549120 1:88456001-88456023 CCTCTCCCTTGCGCGGTTTTCCA No data
Right 910549127 1:88456038-88456060 GCTTTCCTGCGACTTAGGACTGG No data
910549115_910549127 26 Left 910549115 1:88455989-88456011 CCCCAGAGCAGCCCTCTCCCTTG No data
Right 910549127 1:88456038-88456060 GCTTTCCTGCGACTTAGGACTGG No data
910549123_910549127 8 Left 910549123 1:88456007-88456029 CCTTGCGCGGTTTTCCAAGCGGT No data
Right 910549127 1:88456038-88456060 GCTTTCCTGCGACTTAGGACTGG No data
910549121_910549127 9 Left 910549121 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG No data
Right 910549127 1:88456038-88456060 GCTTTCCTGCGACTTAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910549127 Original CRISPR GCTTTCCTGCGACTTAGGAC TGG Intergenic