ID: 910550331

View in Genome Browser
Species Human (GRCh38)
Location 1:88467344-88467366
Sequence GCCCACGGCGCCGGGGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910550331_910550340 1 Left 910550331 1:88467344-88467366 CCCCAGCCCCCGGCGCCGTGGGC No data
Right 910550340 1:88467368-88467390 CCTGTGCAGCCTGAGCCTCCTGG No data
910550331_910550344 26 Left 910550331 1:88467344-88467366 CCCCAGCCCCCGGCGCCGTGGGC No data
Right 910550344 1:88467393-88467415 GAGCGCCGCCCCCTGCTCCACGG 0: 200
1: 415
2: 511
3: 317
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910550331 Original CRISPR GCCCACGGCGCCGGGGGCTG GGG (reversed) Intergenic
No off target data available for this crispr