ID: 910556030

View in Genome Browser
Species Human (GRCh38)
Location 1:88533979-88534001
Sequence TTGTATAAGAATTAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910556030_910556032 6 Left 910556030 1:88533979-88534001 CCTTCCTGCTAATTCTTATACAA No data
Right 910556032 1:88534008-88534030 TGATTTGTATAGACCAAACATGG No data
910556030_910556034 30 Left 910556030 1:88533979-88534001 CCTTCCTGCTAATTCTTATACAA No data
Right 910556034 1:88534032-88534054 TCTAACCAATCAATATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910556030 Original CRISPR TTGTATAAGAATTAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr