ID: 910556611

View in Genome Browser
Species Human (GRCh38)
Location 1:88541546-88541568
Sequence GATCCCTAATGAATGGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910556611_910556621 30 Left 910556611 1:88541546-88541568 CCTTGAGCCATTCATTAGGGATC No data
Right 910556621 1:88541599-88541621 TCTGCTCCACCTCCATCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910556611 Original CRISPR GATCCCTAATGAATGGCTCA AGG (reversed) Intergenic
No off target data available for this crispr