ID: 910556621

View in Genome Browser
Species Human (GRCh38)
Location 1:88541599-88541621
Sequence TCTGCTCCACCTCCATCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910556615_910556621 3 Left 910556615 1:88541573-88541595 CCGTGATCCAAACCTCTGCCCCA No data
Right 910556621 1:88541599-88541621 TCTGCTCCACCTCCATCCTTAGG No data
910556617_910556621 -9 Left 910556617 1:88541585-88541607 CCTCTGCCCCATGATCTGCTCCA No data
Right 910556621 1:88541599-88541621 TCTGCTCCACCTCCATCCTTAGG No data
910556616_910556621 -4 Left 910556616 1:88541580-88541602 CCAAACCTCTGCCCCATGATCTG No data
Right 910556621 1:88541599-88541621 TCTGCTCCACCTCCATCCTTAGG No data
910556614_910556621 4 Left 910556614 1:88541572-88541594 CCCGTGATCCAAACCTCTGCCCC No data
Right 910556621 1:88541599-88541621 TCTGCTCCACCTCCATCCTTAGG No data
910556611_910556621 30 Left 910556611 1:88541546-88541568 CCTTGAGCCATTCATTAGGGATC No data
Right 910556621 1:88541599-88541621 TCTGCTCCACCTCCATCCTTAGG No data
910556613_910556621 5 Left 910556613 1:88541571-88541593 CCCCGTGATCCAAACCTCTGCCC No data
Right 910556621 1:88541599-88541621 TCTGCTCCACCTCCATCCTTAGG No data
910556612_910556621 23 Left 910556612 1:88541553-88541575 CCATTCATTAGGGATCTGCCCCG No data
Right 910556621 1:88541599-88541621 TCTGCTCCACCTCCATCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910556621 Original CRISPR TCTGCTCCACCTCCATCCTT AGG Intergenic
No off target data available for this crispr