ID: 910561903

View in Genome Browser
Species Human (GRCh38)
Location 1:88600017-88600039
Sequence GACAGCTCTTGGCCTGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910561900_910561903 11 Left 910561900 1:88599983-88600005 CCATCTTCTGCAGATAACCACTC 0: 5
1: 190
2: 196
3: 119
4: 360
Right 910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG No data
910561899_910561903 15 Left 910561899 1:88599979-88600001 CCTGCCATCTTCTGCAGATAACC 0: 10
1: 193
2: 189
3: 116
4: 206
Right 910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG No data
910561901_910561903 -6 Left 910561901 1:88600000-88600022 CCACTCTCTTTTTGAGAGACAGC No data
Right 910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG No data
910561898_910561903 16 Left 910561898 1:88599978-88600000 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910561903 Original CRISPR GACAGCTCTTGGCCTGTTAT TGG Intergenic
No off target data available for this crispr