ID: 910565674

View in Genome Browser
Species Human (GRCh38)
Location 1:88640074-88640096
Sequence AGTTATCTGAGAATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910565672_910565674 4 Left 910565672 1:88640047-88640069 CCAAAAGTGATTTCTCAAAAGAA No data
Right 910565674 1:88640074-88640096 AGTTATCTGAGAATGATGGCAGG No data
910565671_910565674 16 Left 910565671 1:88640035-88640057 CCAGATAGCAGACCAAAAGTGAT No data
Right 910565674 1:88640074-88640096 AGTTATCTGAGAATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910565674 Original CRISPR AGTTATCTGAGAATGATGGC AGG Intergenic
No off target data available for this crispr