ID: 910566443

View in Genome Browser
Species Human (GRCh38)
Location 1:88648767-88648789
Sequence AACTTTCAGGTAACTCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910566443_910566448 1 Left 910566443 1:88648767-88648789 CCTGTGTGAGTTACCTGAAAGTT No data
Right 910566448 1:88648791-88648813 ACAGGGTACTTGTAATCTATGGG No data
910566443_910566452 27 Left 910566443 1:88648767-88648789 CCTGTGTGAGTTACCTGAAAGTT No data
Right 910566452 1:88648817-88648839 TCTCCGTGGATGTGGAGATTTGG No data
910566443_910566450 19 Left 910566443 1:88648767-88648789 CCTGTGTGAGTTACCTGAAAGTT No data
Right 910566450 1:88648809-88648831 ATGGGCCATCTCCGTGGATGTGG No data
910566443_910566447 0 Left 910566443 1:88648767-88648789 CCTGTGTGAGTTACCTGAAAGTT No data
Right 910566447 1:88648790-88648812 AACAGGGTACTTGTAATCTATGG No data
910566443_910566449 13 Left 910566443 1:88648767-88648789 CCTGTGTGAGTTACCTGAAAGTT No data
Right 910566449 1:88648803-88648825 TAATCTATGGGCCATCTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910566443 Original CRISPR AACTTTCAGGTAACTCACAC AGG (reversed) Intergenic
No off target data available for this crispr