ID: 910566446

View in Genome Browser
Species Human (GRCh38)
Location 1:88648780-88648802
Sequence CAAGTACCCTGTTAACTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910566446_910566449 0 Left 910566446 1:88648780-88648802 CCTGAAAGTTAACAGGGTACTTG No data
Right 910566449 1:88648803-88648825 TAATCTATGGGCCATCTCCGTGG No data
910566446_910566452 14 Left 910566446 1:88648780-88648802 CCTGAAAGTTAACAGGGTACTTG No data
Right 910566452 1:88648817-88648839 TCTCCGTGGATGTGGAGATTTGG No data
910566446_910566450 6 Left 910566446 1:88648780-88648802 CCTGAAAGTTAACAGGGTACTTG No data
Right 910566450 1:88648809-88648831 ATGGGCCATCTCCGTGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910566446 Original CRISPR CAAGTACCCTGTTAACTTTC AGG (reversed) Intergenic
No off target data available for this crispr