ID: 910566450

View in Genome Browser
Species Human (GRCh38)
Location 1:88648809-88648831
Sequence ATGGGCCATCTCCGTGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910566446_910566450 6 Left 910566446 1:88648780-88648802 CCTGAAAGTTAACAGGGTACTTG No data
Right 910566450 1:88648809-88648831 ATGGGCCATCTCCGTGGATGTGG No data
910566443_910566450 19 Left 910566443 1:88648767-88648789 CCTGTGTGAGTTACCTGAAAGTT No data
Right 910566450 1:88648809-88648831 ATGGGCCATCTCCGTGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910566450 Original CRISPR ATGGGCCATCTCCGTGGATG TGG Intergenic
No off target data available for this crispr