ID: 910569645

View in Genome Browser
Species Human (GRCh38)
Location 1:88684818-88684840
Sequence GTGGCAGGCCAGGGCTTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 389}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910569645_910569655 8 Left 910569645 1:88684818-88684840 CCGCCAAAGCCCTGGCCTGCCAC 0: 1
1: 0
2: 3
3: 40
4: 389
Right 910569655 1:88684849-88684871 TTTGATTCTGCCTACCAGAGGGG 0: 1
1: 0
2: 2
3: 22
4: 192
910569645_910569653 6 Left 910569645 1:88684818-88684840 CCGCCAAAGCCCTGGCCTGCCAC 0: 1
1: 0
2: 3
3: 40
4: 389
Right 910569653 1:88684847-88684869 GGTTTGATTCTGCCTACCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 161
910569645_910569654 7 Left 910569645 1:88684818-88684840 CCGCCAAAGCCCTGGCCTGCCAC 0: 1
1: 0
2: 3
3: 40
4: 389
Right 910569654 1:88684848-88684870 GTTTGATTCTGCCTACCAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910569645 Original CRISPR GTGGCAGGCCAGGGCTTTGG CGG (reversed) Intronic
900177003 1:1295399-1295421 GTGGCAGGGCAGGGCCAAGGAGG - Intronic
900298320 1:1964091-1964113 GAGGCAGGACAGGGCCTTGCTGG + Intronic
900350250 1:2231007-2231029 CTGCCAGGCCAGGGCTCAGGTGG + Intronic
900352301 1:2240985-2241007 GCTGCAGGCGAGGGCTTTGTAGG + Intronic
900512219 1:3066210-3066232 CTGCCTGGCAAGGGCTTTGGGGG - Intergenic
900541095 1:3203210-3203232 GTGGGGGGCCAGGGCTTTGGCGG + Intronic
900716771 1:4149972-4149994 GTGGCAGGAGTGGTCTTTGGAGG + Intergenic
900858014 1:5201448-5201470 GTTGCAGGCCAGGGCCTATGGGG + Intergenic
901044155 1:6385578-6385600 GTGGCTGGCCAGGGATGTGTGGG - Exonic
901051626 1:6428453-6428475 GGGCTGGGCCAGGGCTTTGGGGG + Intronic
901150372 1:7097273-7097295 CAGGGAGGCCAGGGCTTTGATGG + Intronic
901654672 1:10762522-10762544 CGGGCTGCCCAGGGCTTTGGGGG - Intronic
902482696 1:16719908-16719930 GGGCCGGGCCAGGGCTTTGGGGG - Intergenic
903490886 1:23727419-23727441 GTGGGAGGCCGGGGCTGTAGTGG + Intergenic
904599823 1:31667260-31667282 CTGGCAGGCCTTGGCTCTGGAGG + Intronic
905818104 1:40967692-40967714 CTGGCAGGGTAGGGGTTTGGGGG - Intergenic
906087416 1:43147936-43147958 GTGGCAGCCCAAGGCCATGGCGG + Exonic
906345715 1:45013076-45013098 GGGGCAGGGGAGGGCTCTGGAGG + Intronic
906795269 1:48691866-48691888 GTGGAAGGCACGGGCTTTTGTGG - Intronic
907466353 1:54640345-54640367 GTTGGAGGCCAAGGATTTGGAGG + Intergenic
907521885 1:55029280-55029302 GGGGCAGGCAAGGTCTCTGGAGG - Intergenic
907572062 1:55492494-55492516 GTGGAAGGCTGTGGCTTTGGGGG + Intergenic
907730660 1:57062309-57062331 GAGGCTGGCCAGGGCCTTTGGGG - Intronic
907962141 1:59293937-59293959 GTGGCAGGCCAGGGTTGTCTTGG - Intergenic
908664694 1:66477085-66477107 ATAGCAGGCCAGGGCTCTGTAGG - Intergenic
909478603 1:76110495-76110517 GTGGCAAGCCAGAACTTTGCAGG - Intronic
910427955 1:87134250-87134272 GTGGCAGGCCAAGGATTGGAGGG - Intronic
910569645 1:88684818-88684840 GTGGCAGGCCAGGGCTTTGGCGG - Intronic
912775190 1:112502313-112502335 GGTGCAGGGCAGGGCTCTGGCGG - Intronic
912834713 1:112986105-112986127 GCAGCTGTCCAGGGCTTTGGGGG - Intergenic
913481665 1:119294698-119294720 CAGGCAGGGCAGGGATTTGGGGG + Intergenic
915891625 1:159779303-159779325 GTGGGAGGTCAGGGGGTTGGGGG + Intergenic
915940368 1:160115047-160115069 GGGGCAGGCCAGGGCTAGAGGGG - Intergenic
916183833 1:162111921-162111943 GTGGCAGTCCATGGCAGTGGTGG + Intronic
917670483 1:177269161-177269183 GTGCCAGGGCAGGGCTCTAGAGG - Intronic
920227898 1:204451144-204451166 ATGCCAGGCCAGGGCTTGGCTGG + Intronic
921080049 1:211732039-211732061 CTGGCAGCCCAGGGCTCTGGCGG - Intergenic
921800699 1:219399352-219399374 GTGCAAGGCCAGGGCACTGGTGG + Intergenic
922780263 1:228246797-228246819 GTTTCAGGTCAGTGCTTTGGGGG + Exonic
922780709 1:228250234-228250256 GTGGCAGGTCAGTGCTTTGTGGG + Exonic
922781586 1:228256920-228256942 GTGGCAGGTCAGTGCTTTGGGGG + Exonic
922782550 1:228264385-228264407 GTGGCAGGTCAGTGCTTTGGAGG + Exonic
924602935 1:245507376-245507398 GGGGCTGGCCAAGGCTTTGTTGG - Intronic
924673305 1:246150707-246150729 GTGGAAGTCCAGGGGTTGGGGGG + Intronic
1063024735 10:2166433-2166455 GTGTCCGGCCAGGCCTCTGGGGG + Intergenic
1063048259 10:2416279-2416301 CTGGCTGGCTGGGGCTTTGGTGG + Intergenic
1063418018 10:5889567-5889589 GGGGCAGGCCGGGGCTGTGAGGG - Exonic
1064691991 10:17927834-17927856 GTTGGTGGCCAGGGCTTGGGTGG - Intergenic
1064937643 10:20696232-20696254 GAGCCAGGCCATGCCTTTGGAGG - Intergenic
1065111984 10:22449328-22449350 GTGACAGGCCAAGGAGTTGGAGG + Intronic
1067069172 10:43119813-43119835 GTGGCAGGCCAGGGTGTGGGTGG - Intronic
1067317145 10:45179831-45179853 GTGGCAGGCCGGTTTTTTGGAGG + Intergenic
1067317484 10:45181638-45181660 GTGGCAGGCCGGTTTTTTGGAGG + Intergenic
1069812775 10:71174802-71174824 GTGGGAGACCAGGGCTTGGCAGG - Intergenic
1069833286 10:71293953-71293975 CTGGCCGGCCAGGGCTGTGTGGG - Intronic
1070274578 10:74993198-74993220 GAAGCAGTCCAGGGCTTGGGAGG - Intronic
1071200970 10:83220402-83220424 GTGGCAAGCCAGGGCATTTTAGG - Intergenic
1071563780 10:86661421-86661443 TCGGCAGGCCAGGCCCTTGGAGG - Intronic
1072555655 10:96512449-96512471 GTGGCCGGCCAGGTCTCTGCGGG - Intronic
1073470873 10:103721362-103721384 GCAGCAGGCCATGGCTTTGTGGG - Intronic
1075012365 10:118885588-118885610 GTGGCTGGCCTGGGGTTAGGGGG + Intergenic
1076251368 10:128986409-128986431 GTTGCAGGCCTGGGTTATGGTGG - Intergenic
1076446220 10:130516086-130516108 GTCGCAGGACAGGGGTTTGCAGG - Intergenic
1076527529 10:131121711-131121733 GAGGCAGGCCAGGGCCGAGGGGG - Intronic
1076527558 10:131121860-131121882 GAGGCAGGCCAGGGCTGAGGGGG - Intronic
1076764306 10:132624812-132624834 GGGGCAGGCCAGGGCGGGGGTGG - Intronic
1077168900 11:1157735-1157757 CCTGCAGGCCAGGGCTTGGGGGG + Intergenic
1077173640 11:1179183-1179205 ATGGCAGGCCTGGGCGTAGGCGG - Intronic
1079006458 11:16794624-16794646 GTGGGAGGACTGGGCTGTGGGGG + Exonic
1079116629 11:17644200-17644222 GTGGCAGTCCGAGGCATTGGTGG - Intronic
1079328698 11:19516349-19516371 GTGGCAGTTCTGGACTTTGGGGG - Intronic
1080091590 11:28355106-28355128 GTAGCAGGCAAGTACTTTGGGGG - Intergenic
1080428786 11:32179585-32179607 GAGGCAGGCCAGAGTTGTGGGGG - Intergenic
1081642427 11:44765292-44765314 GTGACAGGTCAGGGGTTGGGAGG + Intronic
1082870771 11:57942535-57942557 GTTGTAGCCCAGTGCTTTGGTGG + Intergenic
1084036717 11:66515743-66515765 GTGGAGGGCCAGGGTTTGGGAGG + Intronic
1084402801 11:68955097-68955119 GTTGCAGGCCTGAGCTTTGTTGG + Intergenic
1084421906 11:69064456-69064478 GTGGCAGGAGAGGGCGTGGGAGG - Intronic
1085481864 11:76829722-76829744 GTGACAGGGAAGGGCTGTGGGGG - Intergenic
1089122566 11:116147740-116147762 GTGGCAGGCCAGGGTGTTCTTGG - Intergenic
1089339807 11:117749670-117749692 CTGGCAGGCAAGGGCAGTGGAGG + Intronic
1090965279 11:131592766-131592788 GTGGCAGGCCAGGGCTGGCAAGG - Intronic
1091099430 11:132856742-132856764 GTGGCATGCCAGCACTTCGGAGG - Intronic
1091223749 11:133945876-133945898 GTGGGAGGAGAGGGCTGTGGAGG - Intronic
1091441900 12:517481-517503 GTGGGAGGCGAGGGGGTTGGAGG + Intronic
1093195353 12:16124078-16124100 GTGCCGGGCCAGTGCTTTAGGGG - Intergenic
1094192061 12:27708136-27708158 GTGGCTTGCCAGGACTTGGGAGG - Intergenic
1094251609 12:28368955-28368977 GTGTCAGGGGAGGGCCTTGGTGG - Intronic
1096499935 12:52058622-52058644 GGGGGAGGCTGGGGCTTTGGGGG + Intronic
1096513707 12:52145369-52145391 GTGGCAGGCCTGGGCTTTCTGGG + Intergenic
1096623329 12:52878101-52878123 AGGGCAGGCCAGGCCCTTGGAGG + Intergenic
1097130328 12:56806581-56806603 GTGGCAGGCCAGGTCATTTTAGG - Intergenic
1097158695 12:57030353-57030375 GTGGGAGGGCAGGGCTGGGGAGG + Intronic
1097747290 12:63315316-63315338 GTGGCAAGCCAGGGCATTTTAGG - Intergenic
1098996468 12:77126432-77126454 GTGGCTTCCCAGGGCTTAGGGGG + Intergenic
1099175095 12:79412227-79412249 GTGGCCCGCCAGTGCTTAGGAGG + Intronic
1100327142 12:93550471-93550493 GGGGCAGGGCAGGGCTAGGGAGG + Intergenic
1100641240 12:96484131-96484153 GTGGCAGGCCAGGGTTGTCTTGG - Intergenic
1101455130 12:104824203-104824225 GTGGCAGGCCAGGGTGTTCTTGG - Intronic
1102037604 12:109781192-109781214 GTGGCAGGTCAGCTCTCTGGAGG - Intergenic
1102111817 12:110370952-110370974 GTGGCAGGCCAGGGCCTGCGCGG - Intergenic
1102333264 12:112054530-112054552 GTGGCAGGCCCTGACTTTGCTGG - Exonic
1103432813 12:120903436-120903458 GAGGCAGGCCAGGGCAAAGGTGG - Intronic
1103527378 12:121577853-121577875 TGGGAAGGCCAGGGCTCTGGAGG + Intronic
1103925682 12:124422393-124422415 CAGGCAGGCCAGGGCCTTGTGGG + Intronic
1104604924 12:130180807-130180829 TTAGCAGGTGAGGGCTTTGGGGG - Intergenic
1105529825 13:21209123-21209145 GGGGCTGCCCAGGGCTGTGGGGG + Intergenic
1105618235 13:22040903-22040925 GTGGCAGGCCAGGGCGGTCTTGG - Intergenic
1105673472 13:22644767-22644789 GTGGCAGGCCAGGGCGGTCTTGG + Intergenic
1106101499 13:26697682-26697704 GTGGCATCCCAGGGTTTGGGGGG - Intergenic
1106319398 13:28624101-28624123 GTGGCAGGCCAGGGTGTTCTTGG - Intergenic
1107684717 13:42885552-42885574 GTGGCCGGCCAGCACTTGGGAGG + Intergenic
1110290205 13:73796993-73797015 GTGGCTGTCTAGGGGTTTGGAGG + Intronic
1112506257 13:99978034-99978056 GCGGCAGGCCGGGGCTTGAGCGG - Intergenic
1113535861 13:111065900-111065922 GTGACCGGCCAGCGCTTGGGCGG - Intergenic
1114049829 14:18913751-18913773 GGGGCAGGCCAGGGCTCGTGCGG - Intergenic
1114184421 14:20389410-20389432 GTGGTAGGCTAGGGCTAGGGTGG + Intronic
1117591018 14:57268574-57268596 GTGGCAGGCCCGGGGTTTGCAGG - Intronic
1118203317 14:63697963-63697985 GTTGCAGGCCAGAGCTAAGGGGG + Intronic
1118734316 14:68690965-68690987 GGCCCAGGCCAGGGCTCTGGAGG + Intronic
1118748108 14:68788887-68788909 TTGCCAGACCAGGGTTTTGGGGG - Exonic
1118989837 14:70787862-70787884 GTAGCAGCCCAGGTGTTTGGTGG - Intronic
1119406451 14:74402474-74402496 GTGGCAGGCCAGGGGTCCTGGGG - Intergenic
1119617499 14:76108320-76108342 GTGGCAGGAAAGGGCTTGGCAGG - Intergenic
1120384472 14:83827053-83827075 GTGGCAGGACATGGATTTTGCGG - Intergenic
1121224252 14:92309626-92309648 GTGGAAGCCCTAGGCTTTGGGGG - Intergenic
1121528846 14:94638647-94638669 GAGGCAGGAAAGGGGTTTGGGGG - Intergenic
1122116682 14:99531114-99531136 GTGGCAGGCCAGGGGAGAGGTGG + Intronic
1122689054 14:103522962-103522984 GTGGGCGGCCAGGGTGTTGGGGG - Exonic
1122746020 14:103897682-103897704 GTGACAGGCCAGGGTTTCAGGGG - Intergenic
1122790895 14:104183760-104183782 GTGGATGGCCAGGGCTGAGGCGG + Intergenic
1122889144 14:104724536-104724558 GTGACCGGCCAGGGCATGGGAGG - Intronic
1123406725 15:20023961-20023983 GTGGCCTGCCAGTGCTTCGGAGG + Intergenic
1123473650 15:20572051-20572073 GTGGGAGGCCAGGGCATGGCAGG + Intergenic
1123516054 15:21030609-21030631 GTGGCCTGCCAGTGCTTCGGAGG + Intergenic
1123644359 15:22428302-22428324 GTGGGAGGCCAGGGCGTGGCAGG - Intergenic
1123733950 15:23167062-23167084 GTGGGAGGCCAGGGCATGGCAGG + Intergenic
1123943637 15:25228530-25228552 GTAGCAGGCCTGGGCAGTGGAGG + Intergenic
1124101945 15:26703848-26703870 GGGGCTGCCCAGGGCTTTGGGGG - Intronic
1124284453 15:28388373-28388395 GTGGGAGGCCAGGGCATGGCAGG + Intronic
1124298244 15:28523241-28523263 GTGGGAGGCCAGGGCATGGCAGG - Intronic
1126982081 15:54255662-54255684 GTGGCAGGCCAGGGTTTCTTGGG + Intronic
1128775703 15:70318517-70318539 CTGGAAGGCCAGAGCTGTGGTGG - Intergenic
1128984601 15:72210264-72210286 ATGGCAACCCAGCGCTTTGGAGG + Intronic
1129457378 15:75683094-75683116 GTGGCAGCCCAGGGCCGGGGAGG - Intronic
1129465460 15:75722097-75722119 CGGGGAGGCCAGGGCATTGGTGG + Intergenic
1130274448 15:82469199-82469221 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130466795 15:84196573-84196595 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130497469 15:84476963-84476985 GTGGCAGCCCAGGGCCGGGGAGG - Intergenic
1130589090 15:85201166-85201188 GTGGCAGCCCAGGGCCGGGGAGG + Intergenic
1130927395 15:88395931-88395953 GTGGCAGGCCAGGGTGTTCTTGG + Intergenic
1131024577 15:89129244-89129266 GAGGCAGGCCATGGCTAGGGTGG + Intronic
1131968041 15:97866482-97866504 GAGGCAGGGCAGGGCTTGAGTGG - Intergenic
1132501873 16:288078-288100 GTGCCAGGCGAGGCCCTTGGCGG - Exonic
1132543179 16:520984-521006 TTGGCAGCCCCGGTCTTTGGCGG - Exonic
1132582910 16:693681-693703 GCGGCGGGCCATGGCTTTGGCGG + Exonic
1132787758 16:1667449-1667471 GTGGCAGCTCAGGGCACTGGAGG - Intronic
1132855288 16:2042234-2042256 GTGGTTGGGCAGGGCTGTGGGGG - Intronic
1137056890 16:35750268-35750290 GGGGCAGTCCTGGGCTGTGGCGG - Intergenic
1139963031 16:70728774-70728796 GTGGAAGGAGAGGCCTTTGGAGG - Intronic
1140818967 16:78645829-78645851 TTGGCAGGGCTGGGCTCTGGGGG + Intronic
1141127434 16:81410810-81410832 GTGGCTGGCTAGGGCTCTGCAGG + Intergenic
1141909910 16:87051736-87051758 GCAGCAGGACAGGGCTCTGGAGG - Intergenic
1141949826 16:87333315-87333337 GTGCCGGGCCAGTGCCTTGGTGG - Intronic
1142147563 16:88498966-88498988 GAGGCAGGCCTGGGGTCTGGTGG - Intronic
1142175223 16:88642160-88642182 GGGGCAGGGCAGGGCGCTGGGGG + Intergenic
1142256284 16:89015291-89015313 GAGGGGGGCCACGGCTTTGGCGG + Intergenic
1143172215 17:4936927-4936949 GTGGAAGGCCAGGGCTTAAGTGG - Intergenic
1143649445 17:8254443-8254465 GGAGCAGGCTAGGTCTTTGGAGG - Intronic
1143982662 17:10883493-10883515 TGGGCAGTCCAGGGCTTTGCAGG + Intergenic
1144300820 17:13921966-13921988 GTGGCAGGCCAGGGTTGTCTTGG - Intergenic
1144425042 17:15133660-15133682 GTGGGGGGCCAGGGGTGTGGGGG - Intergenic
1144727208 17:17507909-17507931 CAGCCAGGCCAGGGCTCTGGGGG - Intronic
1145250316 17:21293683-21293705 GAGGCAGGGCAGGGCTGTGGAGG + Intronic
1146901404 17:36591869-36591891 GAGGCAGGCCGGGACTCTGGTGG + Exonic
1147428493 17:40357396-40357418 GGGGCAGGCCAGGGAAATGGAGG - Intronic
1147661786 17:42120908-42120930 GGGGCATCCCAGGGCTCTGGTGG - Intronic
1147771635 17:42872228-42872250 GTCCCAGTCCAGGGATTTGGAGG - Intergenic
1147945726 17:44079096-44079118 GTGGCAGGCCAGAGGTCTGAGGG - Intronic
1148113676 17:45162184-45162206 GAGGCAGGCCAGGACCTTAGAGG + Intronic
1148216331 17:45835734-45835756 CAGCCAGGGCAGGGCTTTGGGGG + Exonic
1148798962 17:50211122-50211144 GGGGCAGGCCAGGGCTGCTGGGG - Intergenic
1149007030 17:51816922-51816944 GTGGGATGACAGGACTTTGGTGG - Intronic
1149318180 17:55458509-55458531 GTGGCAGGCCAGGGTGGTGTCGG - Intergenic
1149849923 17:60028246-60028268 GGGGCAGGGCTGGGGTTTGGGGG + Intergenic
1149860245 17:60118278-60118300 GGGGCAGGGCTGGGGTTTGGGGG - Intergenic
1150125041 17:62629831-62629853 GTGGCAGGCCAGTGCTGCTGGGG + Intronic
1150729163 17:67676964-67676986 GTGGCAAGCCAGTGCTTTTGCGG - Intronic
1150866774 17:68859220-68859242 GAGGCAGTCCAAGACTTTGGTGG + Intergenic
1152645070 17:81465066-81465088 GCAGCAGGCCAGGGGTTTGGGGG - Exonic
1153719208 18:7884563-7884585 GTGCAGGGGCAGGGCTTTGGTGG - Intronic
1153988556 18:10374845-10374867 GTGGCAGGCAAGGGCTTCACGGG + Intergenic
1154206667 18:12343408-12343430 GAGGCGGGCCAGGGGTGTGGGGG - Intronic
1154280024 18:12994364-12994386 GTGGTAGGGGTGGGCTTTGGGGG + Intronic
1156036682 18:32772340-32772362 CAGGCAAGCCAGAGCTTTGGGGG - Intronic
1158255276 18:55539314-55539336 ATGTCTGGCAAGGGCTTTGGTGG + Intronic
1158391484 18:57048909-57048931 GCCTCAGGCCAGGGCTCTGGAGG + Intergenic
1158514501 18:58119836-58119858 CTGGCAGGCCTGGACATTGGCGG + Intronic
1158531590 18:58267712-58267734 GTGTCATGCCAGGGCGTGGGTGG + Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160765487 19:805741-805763 GTGGTAGGACAGGGCTGTGGAGG + Intronic
1160855977 19:1218172-1218194 TCGGCCGGCGAGGGCTTTGGAGG - Intronic
1161257042 19:3315284-3315306 GAGGCAGGCGAGGGCTTGGCCGG - Intergenic
1161273639 19:3404011-3404033 GGGGCAGGCCAGGGGCTGGGGGG - Intronic
1161342512 19:3751003-3751025 GTGGCAGGCAAGGGATGAGGTGG + Exonic
1161614933 19:5264868-5264890 GTGGCAGGCGTTGGCTCTGGGGG - Intronic
1162301585 19:9847983-9848005 GTGCCAGGTCAGGGGTTGGGGGG - Intronic
1163598571 19:18234368-18234390 GGGGCAGGCCTGGGGTTTGAGGG - Intronic
1164673541 19:30087353-30087375 GTGGCATCACAGGGCTGTGGGGG - Intergenic
1164759850 19:30720436-30720458 GTGGGAGGTCTGGGCTTTAGAGG + Intergenic
1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG + Intronic
1165444187 19:35848014-35848036 GTGCCACGCCAGGGCTATGGGGG - Intronic
1165815139 19:38637210-38637232 GTGGCAGCCCAGCCCTGTGGTGG + Intergenic
1166473755 19:43102683-43102705 ATGGCAGGCCAGGGCATTTTAGG - Intronic
1166487706 19:43227748-43227770 GTGGCAAGCCAGGGCATTTGAGG - Intronic
1166494538 19:43289620-43289642 GTGGCAAGCCAGGGCATTTGAGG - Intergenic
1166602078 19:44105120-44105142 GTAGCTGGCCACGCCTTTGGGGG - Intronic
1166765931 19:45252023-45252045 GTGCCAGGGCCGGGCCTTGGGGG - Intronic
1167087571 19:47320681-47320703 GTGGCCGGCCAGGGCTTCCAGGG + Exonic
1167197334 19:48039347-48039369 ATGGAAGGCCAGGGCTTGTGGGG - Intronic
1167245278 19:48369366-48369388 GTCACAGCCCAGGGTTTTGGGGG + Intronic
1167294235 19:48639982-48640004 GTGGGAGGCCAGTTCTGTGGAGG + Intronic
1167385977 19:49163907-49163929 GAGGCATGCCAGGGCCCTGGAGG + Intronic
1167569243 19:50276693-50276715 GAGGAAGGCAGGGGCTTTGGGGG - Intronic
1167638052 19:50666744-50666766 CTGGACGGCCAGGCCTTTGGGGG - Exonic
1167748099 19:51364574-51364596 GTGGAAGGCCAGGGCTGGGATGG + Intronic
1168492842 19:56824627-56824649 GTGGCAGACAAGTGCTTTGGAGG + Exonic
925899198 2:8496299-8496321 GTGTCAGGCCCGGGCTGTGCAGG - Intergenic
926062633 2:9813739-9813761 GGGACTGGCCAGGCCTTTGGAGG - Intergenic
930017830 2:46983133-46983155 GTGGTAGGCCAGGGAGGTGGTGG + Intronic
932586904 2:73036206-73036228 ATGGCAGCTCAGGGCTTGGGGGG - Intronic
933810716 2:86031296-86031318 CGTGCAGGCCAGGGCTTGGGTGG - Intronic
934855060 2:97724487-97724509 GGGGCAGTCGAGGGTTTTGGGGG + Intronic
934861176 2:97764681-97764703 ATGGCAGGCCAGCCCTCTGGAGG - Intronic
935876762 2:107515605-107515627 GTGGCAGGCCAGGGCTGTCTTGG + Intergenic
936956643 2:118029197-118029219 GTGGCCTGCCAGGACTTGGGAGG - Intergenic
937056769 2:118944053-118944075 ATGGCAGGACAGGGCTGGGGAGG + Intronic
937106285 2:119316971-119316993 ATTGCAGGCCATGGCCTTGGTGG + Intronic
938288386 2:130136795-130136817 GGGGCAGGCCAGGGCTTGTCTGG + Intergenic
938427195 2:131202094-131202116 GGGGCAGGCCAGGGCTTGTCTGG - Intronic
939080979 2:137661831-137661853 GTGGCCTGCCAGGACTTGGGAGG + Intronic
939748171 2:146004106-146004128 CTGGCAGGCCTGGATTTTGGGGG + Intergenic
939957243 2:148537368-148537390 GTGCCTGGCCAGGGCTTGGATGG + Intergenic
941706797 2:168667381-168667403 GAGGCAGGGCTGGGCTTGGGTGG - Intronic
941974347 2:171386782-171386804 GTGGCAGGCCAGGGCGGTCTTGG - Intronic
943014482 2:182494729-182494751 GAAGCAGGCCTGGGCTTGGGAGG - Intronic
944676349 2:202036092-202036114 GTAGCAGGCCAGGACGATGGTGG - Exonic
945257280 2:207813199-207813221 GTGGCAGGGCAGGGCGGGGGTGG - Intergenic
946189812 2:218002276-218002298 GTAGCAGGGGAGGGCTGTGGAGG + Intronic
946493485 2:220172271-220172293 GTGGCATCCCAGGGCCTTTGAGG - Intergenic
946571601 2:221029784-221029806 GTGGCAGGCATGGTGTTTGGAGG + Intergenic
948139394 2:235661511-235661533 GGGGCTGGCCAGGGCTGTGGGGG + Intronic
948672879 2:239579730-239579752 GTGGCAGGCAAGAGCGTTTGTGG + Intronic
1168905664 20:1401515-1401537 GTGGCAGCCCAAGGCTTGGATGG - Intergenic
1169084490 20:2818340-2818362 GGGGATGGCCAGGGCTTGGGTGG - Intronic
1170818899 20:19739440-19739462 GAGGCTGGCCACGGGTTTGGGGG + Intergenic
1171331230 20:24340358-24340380 GTGGAAGCCCAGGACTTGGGTGG - Intergenic
1172762742 20:37333533-37333555 GAGGGAGGCCAGGGCTGGGGAGG + Intergenic
1173905626 20:46626572-46626594 GAGGCAGGGCAGGCATTTGGGGG - Intronic
1174413248 20:50349626-50349648 GAGCCAGGCCAGGGGTTTGGGGG - Intergenic
1175218006 20:57401514-57401536 GAGGCAGGCCCCGGCTTTGCAGG - Intronic
1175619514 20:60431510-60431532 GAGGCAGGGCAGGGCATAGGTGG + Intergenic
1175831128 20:61965940-61965962 GTGGCAGGCCAGGGGAGGGGCGG - Intronic
1175908417 20:62393087-62393109 CTGGCAGGCCAGCGCCATGGCGG + Intronic
1176412644 21:6457409-6457431 GGGGCGGGGCAGGGCTTGGGGGG - Intergenic
1176429995 21:6569657-6569679 CTGGAAGGCCAGGGCTGTGCTGG + Intergenic
1179688138 21:43065731-43065753 GGGGCGGGGCAGGGCTTGGGGGG - Intronic
1179705389 21:43177119-43177141 CTGGAAGGCCAGGGCTGTGCTGG + Intergenic
1180189159 21:46154433-46154455 GAGGCGGGCCAAGCCTTTGGGGG + Intronic
1180791442 22:18577572-18577594 CTGGCAGGCCCGGGCTTTGTGGG - Intergenic
1181230297 22:21417739-21417761 CTGGCAGGCCCGGGCTTTGTGGG + Intronic
1181248353 22:21517124-21517146 CTGGCAGGCCCGGGCTTTGTGGG - Intergenic
1181447852 22:22992412-22992434 GTGGAAGCCCAAGGCTGTGGAGG + Intergenic
1181836868 22:25617603-25617625 GTGGCTGCCCAGGGCTGGGGTGG - Intronic
1181990095 22:26830685-26830707 CTGCCAGGCCAGGAATTTGGGGG - Intergenic
1182257323 22:29048611-29048633 CTGGCAGCCCTGGGTTTTGGAGG + Intronic
1182843229 22:33409208-33409230 GCGGCAGGCAAGGGCTCAGGGGG + Intronic
1183441141 22:37823784-37823806 CTGGCTGGGCAGGGCTGTGGGGG + Intronic
1183538249 22:38415524-38415546 CAGGCAGCCCAGGGGTTTGGTGG + Intergenic
1183693566 22:39405562-39405584 CTGGCAGGCCTGGCATTTGGGGG + Intronic
1183746899 22:39697377-39697399 CTCGCAGGCCAGGGCTGTGGGGG - Intergenic
1184096424 22:42318709-42318731 GTGGAAGCCCAGGGCTTATGAGG + Intronic
1184570136 22:45317799-45317821 GTGGCAGGCCAGAGCTCTGCAGG + Intronic
1185012226 22:48320750-48320772 GTGTCAGGGCTGGGCTTGGGAGG - Intergenic
1185041452 22:48506523-48506545 GTGACAGGCGGGGCCTTTGGAGG + Intronic
1185334578 22:50265889-50265911 GTGCCTGGCCAGGGCAGTGGGGG - Intronic
1185334596 22:50265936-50265958 GTGCCTGGCCAGGGCAGTGGGGG - Intronic
1185334613 22:50265981-50266003 GTGCCTGGCCAGGGCAGTGGGGG - Intronic
949461827 3:4302792-4302814 TTGGCAGGGCAGGGGTTTGGAGG + Intronic
949712316 3:6885562-6885584 GAGGCAGGACTAGGCTTTGGGGG - Intronic
949928590 3:9060773-9060795 GTGGCTGTGCAGGGCTTGGGTGG - Intronic
950430378 3:12947561-12947583 GCTGGAGGCCAGGGCTTTGGGGG - Intronic
950531322 3:13553799-13553821 GTGCCGGGCCAGGGATGTGGAGG + Intronic
950965383 3:17142378-17142400 GGGGGAGGCCAGGACTTGGGGGG + Intergenic
951845447 3:27079822-27079844 CTGGCAGGCAAGGTCTTGGGAGG - Intergenic
952722414 3:36546933-36546955 TAGGCAGGTCAGGTCTTTGGAGG - Exonic
953374495 3:42417257-42417279 GTGGCAGCCCTGGGCCTTGGAGG + Intergenic
953586098 3:44202420-44202442 GTGGAAGGCAAGGGCCATGGTGG + Intergenic
954108174 3:48420174-48420196 AGGGGTGGCCAGGGCTTTGGGGG + Exonic
954303903 3:49715568-49715590 GTGGAAGGGCAGGGCTCTGCAGG - Exonic
954701383 3:52452660-52452682 GGGTCACGTCAGGGCTTTGGGGG - Intronic
955319084 3:57961444-57961466 GTGGCTTGCCAGCGCTTGGGCGG + Intergenic
955470566 3:59282253-59282275 CTGGAAAGCGAGGGCTTTGGTGG + Intergenic
960415748 3:117383149-117383171 GTGGCAGGCCAGGGTTGTCTTGG - Intergenic
961360463 3:126364205-126364227 GCGGCAGGCCACTGCTTGGGAGG - Intergenic
961573554 3:127817251-127817273 GTGTGAGGGCAGGGCTCTGGAGG + Intronic
961726796 3:128936083-128936105 GTGCCAGGGCAGGGCTTGGAGGG - Intronic
964399667 3:156285744-156285766 TTGGGAGGCCAAGGCTTAGGTGG - Intronic
965197851 3:165623113-165623135 GTGGCAAGCCAGGGCATTTTAGG - Intergenic
968609427 4:1550345-1550367 GGGGCAGGGGAGGGCATTGGTGG - Intergenic
968788681 4:2643814-2643836 CTGGCAGGCCAAGGCGTAGGCGG + Intronic
968818111 4:2832152-2832174 CTGGCTGGCCAGGGCTCTGCTGG + Intronic
969056282 4:4404873-4404895 GGGCCTGGCCAGGGCTTTGAAGG + Intronic
969396303 4:6923820-6923842 GCTGCGGGTCAGGGCTTTGGAGG - Exonic
969448864 4:7261559-7261581 TTTGCAAGCCAGGGCTTTTGAGG - Intronic
969450096 4:7268126-7268148 GGGGCAGTCCATGGCCTTGGAGG + Intronic
969458624 4:7315466-7315488 GGGGCAGGCCAGGGCTGGTGCGG + Intronic
969565269 4:7973688-7973710 TTGGCAGGGCAGGGCTTAGCAGG - Intronic
970772334 4:19628834-19628856 TTAGCAGGCCAGGCCTTTGAAGG - Intergenic
970772462 4:19630341-19630363 TTAGCAGGCCAGGCCTTTGAAGG - Intergenic
971365452 4:25973382-25973404 GTTGAAAGCAAGGGCTTTGGAGG - Intergenic
973621112 4:52726937-52726959 GTGACAGCCCAGGGCTTTCCTGG - Intronic
975300257 4:72782213-72782235 GTAGCAGGCCATGGGTTAGGTGG - Intergenic
975639806 4:76489028-76489050 GTGCCTAGCCAGGGCTCTGGAGG + Intronic
976313263 4:83633537-83633559 GAGGCAGGACAGGGATGTGGAGG + Intergenic
977582897 4:98744660-98744682 GTGGCCTGCCAGGACTTAGGAGG + Intergenic
980252511 4:130335909-130335931 GTGGCCTGCCAGGACTTTGGAGG - Intergenic
981450059 4:144886359-144886381 GTGGCTGGTCAGCGCTTGGGAGG - Intergenic
986063706 5:4215627-4215649 GTGGGAGGCAATGCCTTTGGTGG + Intergenic
987086598 5:14475321-14475343 GAGAGAGGCCAGAGCTTTGGAGG - Intronic
987101005 5:14591134-14591156 TTGACCTGCCAGGGCTTTGGTGG - Intronic
990003444 5:50921483-50921505 GGGGCAGGGGAGGGCATTGGTGG + Intergenic
990719322 5:58675973-58675995 GTGGAAGGGCAGGGCTTTCCTGG + Intronic
992040195 5:72823341-72823363 GTGAGAGGCCAGGGTTTGGGTGG - Intronic
996342156 5:122451063-122451085 GTGGCCATCCAGGGATTTGGAGG - Exonic
998078852 5:139258159-139258181 GTGGAAGGCCAGGGCTATGCTGG + Intronic
999045792 5:148468149-148468171 GTGACAGGCCAGGGATTGGTTGG + Intronic
1000532782 5:162444515-162444537 GTGGCAGGCCAGGGTGTTCTTGG - Intergenic
1000852910 5:166362295-166362317 GTGGCAGGCCAGGGCAATTTTGG + Intergenic
1001097126 5:168784300-168784322 ATGACAGGCCAGGGCTCTGCAGG - Intronic
1001490380 5:172150691-172150713 GTTGCTGGCCAGGGTTTTTGTGG - Intronic
1002197134 5:177507744-177507766 GTGAGAGGCGAAGGCTTTGGAGG - Intronic
1002346352 5:178550348-178550370 GTGGCTGTCCTGGGCTTTGTAGG + Intronic
1002558962 5:180067491-180067513 GTAGCAGGACAGGGATTTGGTGG + Intronic
1002701104 5:181125569-181125591 GTGGAAAGCCTGGGCTTTGCTGG - Intergenic
1002811170 6:631009-631031 GTTGCAGCCCAGGGCCTTGGAGG - Intronic
1002981606 6:2143640-2143662 GTGGGAGGCCACTGCTTGGGAGG - Intronic
1003302999 6:4901935-4901957 GTGGCAGCCCAGAGCTGCGGGGG - Intronic
1003402180 6:5799772-5799794 GCGGCTGCCCAGGGCTGTGGGGG - Intergenic
1004537442 6:16516214-16516236 GTTCCAAGCCTGGGCTTTGGGGG + Intronic
1004705731 6:18122256-18122278 GTGGCAGGTGAGGGCTCCGGGGG + Exonic
1006153468 6:32001605-32001627 GGGTCAGGCCAGGGCCTCGGTGG - Intronic
1006159776 6:32034342-32034364 GGGTCAGGCCAGGGCCTCGGTGG - Intronic
1007235665 6:40390021-40390043 GAGGAAGGCCTGGGATTTGGAGG + Intergenic
1007522201 6:42459448-42459470 GTGGCATGCAAGGGCTATGGTGG + Intergenic
1007629943 6:43267843-43267865 GTGGCAGGGAAATGCTTTGGTGG - Intronic
1007909053 6:45494913-45494935 GTGGTATGCCAGGGCTGGGGAGG - Intronic
1008082053 6:47204914-47204936 GAGGCAGGGCTGGGCTGTGGAGG - Intergenic
1008665386 6:53710879-53710901 GTGACAGACCAGGGCCTGGGAGG - Intergenic
1011267567 6:85539288-85539310 GTGCCATGCCAGGTTTTTGGTGG - Intronic
1013131403 6:107236881-107236903 ATGGCAGCACAGGGCTTTGCAGG + Intronic
1017282192 6:152637061-152637083 GTGGCGGGCCAGGGCGGTGCAGG - Intronic
1017570960 6:155743505-155743527 CTGACAGCCCAGGGCCTTGGTGG - Intergenic
1017757989 6:157545750-157545772 GAGGAAGGAGAGGGCTTTGGAGG + Intronic
1017926304 6:158914260-158914282 AAGGCAGGCCAAGGCTATGGTGG - Intergenic
1018892139 6:167989960-167989982 GGGGCTGCCCTGGGCTTTGGGGG - Intergenic
1018957708 6:168421499-168421521 GCGGCTGGCCAGGGCGCTGGGGG - Intergenic
1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG + Intronic
1023609025 7:41955961-41955983 GAGACAGGCCAGGGCCCTGGGGG - Intergenic
1026646543 7:72175674-72175696 TAGGCAGACCAGGGCTTTGGAGG + Intronic
1028991836 7:97057093-97057115 GGGGCCGGACAGGGCATTGGGGG + Intergenic
1032094488 7:128931175-128931197 GTGGCAGGCAGGCTCTTTGGGGG + Intergenic
1032788875 7:135227023-135227045 GTGGCAGGGCGGGGATGTGGAGG + Intergenic
1033343012 7:140506570-140506592 GTGACTGGCCAGGGGTTTGGAGG - Intergenic
1033446616 7:141428611-141428633 GTGGCCTGCCAGGACTTGGGAGG - Intronic
1033740852 7:144274710-144274732 GTGGCAGGCCAGGGCACAAGAGG - Intergenic
1033753054 7:144374903-144374925 GTGGCAGGCCAGGGCACAAGAGG + Intronic
1034396103 7:150826075-150826097 TTGGGAGGCCAGGGCTATGATGG + Intronic
1034461734 7:151201251-151201273 ATGGCAGGCCTGGTCTGTGGTGG - Intronic
1034465551 7:151226601-151226623 GGGGCAGGCCAGGGCATCAGAGG - Intronic
1034731357 7:153390166-153390188 GTGGCCTGCCAGCACTTTGGAGG - Intergenic
1035685977 8:1523618-1523640 TCTGCAGGGCAGGGCTTTGGTGG + Intronic
1035748472 8:1978635-1978657 GTGGCAGGCCAGGGACTGAGGGG - Intronic
1036680102 8:10865711-10865733 TTGTCAGTCCAGGGCCTTGGTGG + Intergenic
1039196157 8:35033997-35034019 GCAGCAGGCCTGGGCTTTTGGGG - Intergenic
1041739736 8:61145528-61145550 GAGCCAGGCCAGGTCCTTGGGGG + Intronic
1043043170 8:75287988-75288010 AGGGAAGGCCAAGGCTTTGGGGG + Intergenic
1043479778 8:80641309-80641331 GTGGCAGGCCAGGGCAGGAGCGG + Exonic
1044139928 8:88637680-88637702 GTGGCCGGCCAGCACTTGGGAGG - Intergenic
1044605072 8:94041329-94041351 GTGGCAGGGCAGGGGAGTGGGGG - Intergenic
1045318803 8:101065786-101065808 ATGGCAGGCCAGTTCTGTGGTGG + Intergenic
1046463570 8:114572622-114572644 GTGGCCGGCCAGCACTTGGGAGG - Intergenic
1048015512 8:130493056-130493078 CTGACATGCCAGGGCCTTGGAGG - Intergenic
1048497192 8:134945201-134945223 GAGGCAGGGCAGGGCCTTGAAGG - Intergenic
1049023180 8:139971351-139971373 GTGCCAGGCCAGGAGGTTGGGGG - Intronic
1049239876 8:141531900-141531922 GTGACAGGCCAGTGCTTGTGAGG - Intergenic
1049270856 8:141695484-141695506 GTTACAGGCCAGTTCTTTGGTGG - Intergenic
1050115998 9:2264264-2264286 GTGGCGGGCCATGGCAGTGGCGG + Intergenic
1051978692 9:22986523-22986545 GTGGAAAGCCATGGCTTTTGAGG - Intergenic
1052122657 9:24737960-24737982 GTGGCAGGCCAGGGTGGTGTTGG - Intergenic
1052370091 9:27654863-27654885 GTGGCGGGCCAGGGCGGTGCTGG - Intergenic
1052836872 9:33256998-33257020 CTGGCCTGCCAGGGCTATGGTGG - Intronic
1053480390 9:38412491-38412513 GTGGCAGGAAAGAGCTCTGGAGG + Intronic
1054927295 9:70601664-70601686 CAGGGAGGGCAGGGCTTTGGAGG - Intronic
1055366557 9:75550460-75550482 GTGGCAGGGCAGATCTGTGGAGG - Intergenic
1056427089 9:86488338-86488360 GGGGCAGGGCAGGCCTTGGGTGG - Intergenic
1056527491 9:87456787-87456809 TTTGCAGGCCAGGGATTTTGTGG + Intergenic
1057141683 9:92730121-92730143 GTGGCAGGACAGGGCTTCCATGG + Intronic
1057961751 9:99464062-99464084 GTGACAGGGCAGGGATTTGCTGG + Intergenic
1058508972 9:105695117-105695139 GCGCCAGCCCAGGGCTTGGGCGG + Intronic
1059430622 9:114248178-114248200 GAGACAGGCCAGGGCTCAGGAGG - Intronic
1059448967 9:114358046-114358068 GTGGCACGCCAGGGCCTGGAGGG + Exonic
1060472682 9:123961605-123961627 GTGGGTGACCAGGGATTTGGGGG + Intergenic
1060680422 9:125558097-125558119 GAGGCAGGCCAGGATTTGGGAGG - Intronic
1061033943 9:128103088-128103110 GTGCCAGGCCAGGGCTTGTTAGG + Intronic
1061243327 9:129387001-129387023 GCTGCAGGCCGGTGCTTTGGGGG - Intergenic
1061874483 9:133537008-133537030 TTGGCAGGCGAGGGCTGAGGGGG + Intronic
1061997332 9:134193148-134193170 GTGGAAGGCGAGGGCTTCCGGGG + Intergenic
1062025092 9:134336547-134336569 GTGGCCGGCCGGAGCCTTGGTGG + Intronic
1062117163 9:134815661-134815683 GAGGCAGGCCAGCACTGTGGGGG - Intronic
1186364342 X:8875486-8875508 GTGGCAGGTCAGGGAGTAGGAGG + Intergenic
1188973162 X:36641846-36641868 GTGGCTGGGAAGGGTTTTGGAGG - Intergenic
1190359263 X:49634016-49634038 TTAGCTGGCCAGGGCTTTGTTGG - Intergenic
1192151783 X:68717316-68717338 CTGGCAGGCCAGGGCTCGGTGGG - Exonic
1193836389 X:86349428-86349450 GTGGCAGGCCAGGGTTGTCTTGG + Intronic
1194211332 X:91072660-91072682 GTGGCAGGCCAGGGTTGTCTTGG + Intergenic
1197784525 X:130187010-130187032 GTGGGAGCCCAGCCCTTTGGGGG - Intergenic
1199055089 X:143284565-143284587 GTGGCCTGCCAGCGCTTGGGAGG + Intergenic
1199203589 X:145122175-145122197 GTGGTAGGACAGGACTGTGGTGG + Intergenic
1200229008 X:154434822-154434844 GTGCCTGGGCTGGGCTTTGGGGG - Intronic
1201044825 Y:9871277-9871299 GTGGCAGGCCAGGGTGTTCTTGG - Intergenic
1201765368 Y:17569524-17569546 CTGGCAGTCCAGGGCTTTGCTGG - Intergenic
1201836184 Y:18336465-18336487 CTGGCAGTCCAGGGCTTTGCTGG + Intergenic