ID: 910569981

View in Genome Browser
Species Human (GRCh38)
Location 1:88689059-88689081
Sequence CAGTGACACTGGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910569981 Original CRISPR CAGTGACACTGGAAAGTGGA AGG Intronic
902751110 1:18511745-18511767 TGGTGACACAGGAAAGTGGTAGG - Intergenic
903025812 1:20429324-20429346 CTGTGGCACTGCAAAGTGGAAGG - Intergenic
903322660 1:22552192-22552214 CAGAGGGACTGGGAAGTGGAGGG + Intergenic
906045647 1:42828943-42828965 CAGAGTCACTAGAAAGTTGAGGG + Intronic
907154893 1:52324582-52324604 CAGTGACACTGTCTAGGGGATGG - Intronic
909409153 1:75328964-75328986 CAGAGCCACTTGAAAATGGAGGG + Intronic
910569981 1:88689059-88689081 CAGTGACACTGGAAAGTGGAAGG + Intronic
912596295 1:110880243-110880265 CAGTAACAGTGAAAAGGGGAAGG + Intronic
914217305 1:145643787-145643809 TTGTGAGACTGGAAAATGGATGG + Intronic
914339053 1:146742787-146742809 GAATGACACTGGAAAGTGACTGG - Intergenic
914418600 1:147507673-147507695 AAATGAAACTGGAAAGAGGAAGG - Intergenic
914469874 1:147966472-147966494 TTGTGAGACTGGAAAATGGATGG + Intronic
916535295 1:165698249-165698271 CAGTGACAGTGGAGAGTCTAAGG - Intronic
916648192 1:166809748-166809770 AAATGACACTGGAAACTTGATGG - Intergenic
918309787 1:183277423-183277445 CAGTGACTCTTGAACCTGGAAGG + Intronic
919362763 1:196615352-196615374 CAGCAACACTGAAAAGAGGAAGG + Intergenic
920126085 1:203694865-203694887 CAGTGAAAATGGAAAGTGATTGG + Intronic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
921232011 1:213082522-213082544 AAGTGTTACTGGAAACTGGAGGG + Intronic
922471494 1:225879923-225879945 CATTGTCCCTGGAAAGGGGAGGG + Intronic
923290998 1:232545972-232545994 CAGTGACACCAGAAAGAGAAGGG - Intronic
924030870 1:239884358-239884380 CAGAGCCACTAGAAACTGGAAGG + Intronic
1063089753 10:2852471-2852493 CAGTGACACTGGGGAATGGGTGG - Intergenic
1063384689 10:5608724-5608746 CAGAGACACTGCAAGGAGGAAGG + Intergenic
1064719699 10:18216658-18216680 CATTGAGACTGGAGAGAGGAAGG + Intronic
1064775994 10:18777946-18777968 CAGTGACACTTGAATGGGTATGG - Intergenic
1065412199 10:25441924-25441946 CAGAGACAATGGAACGTGAATGG + Intronic
1066078123 10:31901447-31901469 ACGTGAGCCTGGAAAGTGGAAGG + Intronic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1068015980 10:51516591-51516613 CAGTGACACTGCATTATGGAAGG + Intronic
1069385921 10:67883641-67883663 CAGGGAGAGAGGAAAGTGGAAGG + Intergenic
1070641830 10:78175868-78175890 CAGTCACAGTGGAAGGTGAAGGG - Intergenic
1071405656 10:85328709-85328731 CAGAAACCCTGGAAACTGGAGGG - Intergenic
1071766540 10:88672341-88672363 CAGAGAGACTGGAAAGAGGAGGG + Intronic
1072063411 10:91839708-91839730 CAGTTACACTGAAAATTTGAGGG + Intronic
1072220468 10:93323547-93323569 GAGTGAGAATGGAAAGTGGGTGG - Intronic
1072442805 10:95471764-95471786 CAGTGACAGGAGGAAGTGGAAGG + Intronic
1073499011 10:103919122-103919144 CAGAGACTCTGGAAAATGGCAGG + Intergenic
1073692819 10:105829967-105829989 CAATCACAGTGGAAAGTGAAGGG + Intergenic
1073755610 10:106577586-106577608 TAATGACACTGGAAAGGGAAAGG + Intronic
1075869359 10:125758738-125758760 CAGTGACAGTGGAATATGGCTGG - Intronic
1076318656 10:129562643-129562665 CAGTGACTCTGGCCAGGGGAGGG + Intronic
1076619856 10:131780143-131780165 CAGTGCCTCTGGAACTTGGATGG - Intergenic
1077892567 11:6430056-6430078 CATTGTCACTGGAAGGTGGGTGG + Intergenic
1079234147 11:18675638-18675660 TAGTGACAGTGGAGTGTGGAGGG - Intergenic
1079520469 11:21320537-21320559 CAATGCCCCTGAAAAGTGGATGG + Intronic
1082108907 11:48251233-48251255 CAAGGACACTGAAAAGTTGAAGG - Intergenic
1082821496 11:57547308-57547330 CAGAGCCACTGGAAGGTGGGAGG + Intronic
1083636835 11:64125372-64125394 CAGTGACCCTGGGAAGGGCAAGG - Intronic
1086436332 11:86784593-86784615 CAGTCACTCTGGAAAATTGAAGG + Intergenic
1086960221 11:92973488-92973510 CTGTGACACTGGTGAGAGGAGGG - Intronic
1087681693 11:101225070-101225092 CAGTGGCACTGGAGAGTGGCGGG + Intergenic
1087935192 11:104025689-104025711 CAAGGGCACTGGAAAGCGGAAGG + Intronic
1090038100 11:123265949-123265971 CAGTAACACTGGAAATGGGGAGG + Intergenic
1091790174 12:3267736-3267758 CAAGGTCACTGTAAAGTGGAAGG - Intronic
1094415301 12:30209513-30209535 AAGTCACATTGGAAAGTGAAGGG - Intergenic
1094842187 12:34346826-34346848 CAGGGAGGCTTGAAAGTGGAGGG - Intergenic
1096085977 12:48865377-48865399 CAGGGACGCAGGAAGGTGGAGGG + Intronic
1098050642 12:66448948-66448970 CAGAGAAACAGGAGAGTGGATGG - Intronic
1100143386 12:91646725-91646747 CAAAGACACTGGACAGTGGGAGG + Intergenic
1100717568 12:97322062-97322084 CATAAACACTGGAAAGTGGAAGG + Intergenic
1101816589 12:108150627-108150649 CAGTGACACAGGAGAGAGGCAGG + Intronic
1104169394 12:126265420-126265442 CAGATATACTTGAAAGTGGAAGG + Intergenic
1104624668 12:130341226-130341248 CAGTGGGACTGGAAAGAGAAGGG - Intronic
1105678172 13:22697966-22697988 CAGTGTCACTAGATAGTGAAAGG + Intergenic
1106237191 13:27873060-27873082 AAGTAACACTGGATAGTGCAAGG - Intergenic
1106625625 13:31418159-31418181 CAGGGTCTCTGGAAAGTGAAGGG + Intergenic
1108303830 13:49110217-49110239 CAGTGACCCAGGAAAGGGCAAGG - Intronic
1108570369 13:51743766-51743788 CAGTTTTACTGGAAAGTGGGAGG + Intronic
1108682863 13:52794300-52794322 TTCTGAAACTGGAAAGTGGAGGG - Intergenic
1108782253 13:53850457-53850479 CAGGGACACAGGAAAATGGTGGG - Intergenic
1110437949 13:75496040-75496062 CAGCCACTCGGGAAAGTGGAGGG - Intergenic
1112970944 13:105261518-105261540 CAATGACACTGGTAAGTAAAAGG + Intergenic
1113898534 13:113782731-113782753 TGGGGACACTGGAAAATGGACGG - Intronic
1114676834 14:24446850-24446872 CAGTGACACTTGATAGAGTAAGG - Intergenic
1115369408 14:32595215-32595237 CAGTGACATGGGAGAGTGGCTGG - Intronic
1117431901 14:55675049-55675071 CAGTGACATTTAAAATTGGAGGG - Intronic
1119939729 14:78627511-78627533 CAGTGACTCTGGGACGTTGATGG + Intronic
1120016332 14:79478086-79478108 CAGTGACAGTGGAAGGTTTAAGG + Intronic
1121062127 14:90922154-90922176 CAGTGTCTCTGGAAAGTTAAAGG + Intronic
1121328548 14:93035640-93035662 CTGTGACACTGGTGAGTGGGAGG + Intronic
1121414569 14:93770243-93770265 GACTGACTCTGGAGAGTGGAAGG - Intronic
1121658043 14:95612753-95612775 CAGTGATACTGGCCAATGGAAGG + Intergenic
1122119652 14:99545298-99545320 CAATGACACTGCAATGTGGAGGG + Intronic
1122500105 14:102191733-102191755 CAGTGCCACTGGAAAGGGATTGG + Intronic
1122575104 14:102737145-102737167 CAGGGTCACTGGTAAGTGGAGGG + Intergenic
1122850156 14:104523678-104523700 CAGTCACAGTGGAAGGTGAAGGG + Intronic
1123968142 15:25479552-25479574 CAGTGATAATGGAAATTGCAAGG - Intergenic
1124647857 15:31452707-31452729 CAGTGGCACTGACAAGGGGACGG - Intergenic
1124999217 15:34754108-34754130 CTCTGACTCTGGAGAGTGGAGGG + Intronic
1125375218 15:39021466-39021488 CAGGGCCACAGGAAAGAGGAAGG + Intergenic
1125609031 15:40958498-40958520 CAGTGGGAATGGACAGTGGAGGG + Intergenic
1126121263 15:45253504-45253526 CAGTACCTCTGGTAAGTGGAAGG - Exonic
1127096674 15:55517980-55518002 CAGAGGCAGTGAAAAGTGGATGG - Intergenic
1127391934 15:58512745-58512767 CAGTGGCACTGGAACGAGGTAGG + Intronic
1127885757 15:63199108-63199130 CAGTGAAACAAGAAAGTGGTTGG - Intronic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1129670581 15:77605724-77605746 CAGGGACGCTGGAAGGTTGACGG - Intergenic
1130047825 15:80459963-80459985 CACAGTCACTGCAAAGTGGAGGG - Intronic
1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG + Intronic
1131716267 15:95113963-95113985 CAGCCACAGTGGAAAGAGGAGGG + Intergenic
1133790292 16:9004450-9004472 CAGTGACTCTGGAAGTGGGAGGG - Intergenic
1134090781 16:11390603-11390625 CAGTGGCACTGGAGATTGCAGGG + Intronic
1135650661 16:24203628-24203650 CAGTGACAGTTGAATTTGGAGGG + Intronic
1137254498 16:46763907-46763929 CAGTCACACTAGAAATTGGAAGG + Intronic
1138876198 16:60953387-60953409 CAATCACAGTGGAAAGTGAAAGG - Intergenic
1139995227 16:70974565-70974587 GAATGACACTGGAAAGTGACTGG + Exonic
1140170477 16:72599004-72599026 GACTGACACTGGAGAGTGGGAGG + Intergenic
1141250266 16:82349791-82349813 CAGGGGCACTAGAAAGAGGAAGG + Intergenic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1141908146 16:87041183-87041205 AGGTGATACTGGAAAGTGGCAGG - Intergenic
1141991393 16:87612584-87612606 CACTGACACTGGAAACTTTAAGG + Intronic
1143890684 17:10099901-10099923 CAGGGACAGTGGACAGTGGAAGG + Intronic
1145040162 17:19571948-19571970 CACTGACCCTAGAAAGTTGAAGG - Intronic
1145924938 17:28639787-28639809 CAGTGTAACTGGGGAGTGGAAGG - Intronic
1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG + Intronic
1146638452 17:34523014-34523036 CAGTGTCACTGAAATGTGGGAGG + Intergenic
1147219209 17:38918842-38918864 CAGAGACACTGAAGAATGGACGG - Exonic
1148290047 17:46437941-46437963 TAGTAACACAGGAAAGTGTAAGG - Intergenic
1148312215 17:46655513-46655535 TAGTAACACAGGAAAGTGTAAGG - Intronic
1149608215 17:57939796-57939818 AAGGGTTACTGGAAAGTGGACGG + Intronic
1156354176 18:36327497-36327519 CAGTGACTCTGCAAGGTGGTTGG + Intronic
1156950837 18:42895790-42895812 CAGTCACAATGCAGAGTGGAAGG + Intronic
1157332078 18:46711461-46711483 CAGTGACACTGTTAAGAGCAGGG - Intronic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1157773422 18:50371169-50371191 CTGTGAACTTGGAAAGTGGATGG - Intergenic
1158140095 18:54246474-54246496 CAGTGACTGTGGAAAGTTGTTGG - Intergenic
1158911570 18:62068282-62068304 CAGTGAGACAGTAATGTGGAAGG - Intronic
1159438602 18:68449029-68449051 CAGTCACTGTGGAAACTGGATGG - Intergenic
1161824095 19:6550954-6550976 GAGTTACACAGGGAAGTGGAGGG + Intergenic
1164502746 19:28833211-28833233 CAGTGACACAGGGTAGGGGATGG - Intergenic
1164938306 19:32231736-32231758 CAGTGAAACTGGAGACTGGCAGG + Intergenic
1165120474 19:33555578-33555600 CAGTGACACTGGGGTGGGGAGGG - Intergenic
1166516709 19:43452610-43452632 CAGTGTCATTGGAATGTGAAAGG + Intergenic
1167341563 19:48919386-48919408 CAGTGACCCAGGAGAATGGACGG - Intronic
926337266 2:11873579-11873601 CATTGTCAGTGGTAAGTGGAAGG - Intergenic
926629028 2:15120000-15120022 CAGTGACCCCGGCAGGTGGACGG + Intergenic
930855230 2:56008980-56009002 AATTGCCACTGGAAAGTGAAGGG + Intergenic
931906982 2:66853191-66853213 CTGTGACAATGGGAAGCGGAAGG - Intergenic
931974458 2:67628082-67628104 CAGTGATATTGGAAACTTGATGG - Intergenic
933870556 2:86561685-86561707 GATTGACACTGGAAAATGGCAGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935397641 2:102624668-102624690 CAGTGACACTTGAAAGGAGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935900151 2:107783113-107783135 TAAAGACACGGGAAAGTGGAGGG + Intergenic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936024189 2:109018692-109018714 GAGTGCCAGTGGAAAGGGGATGG - Intergenic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
939048447 2:137278354-137278376 CATCAGCACTGGAAAGTGGAAGG + Intronic
940156362 2:150660975-150660997 CAGTCACAGTGGAAGGTGAAAGG - Intergenic
943243486 2:185417429-185417451 AGGTGACACTGGTAAGTGGTTGG + Intergenic
943918292 2:193667161-193667183 CAGTAAAACTGGAAAGGTGAGGG - Intergenic
945471147 2:210229006-210229028 AAGGGAAACTGGAAAGGGGATGG + Intergenic
945932479 2:215869010-215869032 CAGTGACACTGGAAACTATAGGG - Intergenic
946323421 2:218968119-218968141 AAGTGACACTGGACAGTGTCTGG + Intergenic
948510233 2:238459046-238459068 GAGGGACACTGGTAAGAGGAAGG - Intergenic
948628417 2:239284744-239284766 CCAGGACACTGGAGAGTGGAAGG - Intronic
1169075439 20:2757200-2757222 CGGGGACGCTGGAAAGAGGATGG + Intronic
1169395358 20:5224269-5224291 CAGTGACACTGCACAGTCTAGGG - Intergenic
1169473242 20:5907142-5907164 CAGTGACACAGAAAAGAGCAGGG - Intergenic
1170105461 20:12750546-12750568 AAGGGAGACTGGAAAGGGGAAGG - Intergenic
1170346675 20:15394582-15394604 CACTTACACTGGAAAATGGTGGG - Intronic
1171819726 20:29823708-29823730 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1171898091 20:30829471-30829493 CAGAGACAGTGGAATGTGGAGGG + Intergenic
1171960866 20:31493124-31493146 CAGTGGGACTGGGAAGAGGATGG - Intergenic
1172027686 20:31960249-31960271 TAGTTCCACTGGAAAGAGGATGG + Intergenic
1172775743 20:37405706-37405728 CAGTGACATTGGGGAGTGGGTGG + Exonic
1173811275 20:45957364-45957386 CAGTGATTCTGGAGAATGGACGG + Intronic
1174577424 20:51546457-51546479 GAGTGACTCTGGGAGGTGGAGGG + Intronic
1174996717 20:55577920-55577942 CAGTCATGGTGGAAAGTGGAAGG + Intergenic
1175664539 20:60846994-60847016 CAGAGTCACTGGAAACTGGTAGG + Intergenic
1178850636 21:36209539-36209561 CCGTGACACAGGACAGAGGAAGG - Intronic
1180323728 22:11348399-11348421 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1180663585 22:17490894-17490916 TAGTGACGCTGGGAAGTGGGTGG - Intronic
1180946476 22:19696436-19696458 CACTGACAGTGGAGAGGGGATGG - Intergenic
1181460674 22:23084103-23084125 CAGTGACACTGGACATGGGTAGG - Intronic
1182044856 22:27266376-27266398 CAGTGACTCTGAAAAGAGGCAGG - Intergenic
1182739615 22:32558237-32558259 CAGTAACATTGTAAAGAGGAAGG - Intronic
1183645629 22:39124372-39124394 CAGTGAAGCTGGGAGGTGGACGG + Intronic
1184955923 22:47885826-47885848 CCGGGACAATGGGAAGTGGATGG + Intergenic
949180860 3:1129674-1129696 CATTGACACTGGAAACTTGCTGG - Intronic
949455597 3:4235140-4235162 TAGAGACAAAGGAAAGTGGATGG + Intronic
949660710 3:6275327-6275349 CAGTCACACTGGAAGCTGGTTGG + Intergenic
950902218 3:16508218-16508240 CAGTTACATGGGACAGTGGAGGG - Intronic
952711347 3:36435241-36435263 CAGAGACAGTGGGAGGTGGAGGG - Intronic
953069125 3:39502411-39502433 CAGGGAGACTGGAAGGTGGGTGG + Intronic
953589128 3:44234744-44234766 CTGTGACCCTGGAAAAGGGAAGG + Intergenic
954040905 3:47886794-47886816 AAGTGAAACTGGAATTTGGAAGG - Intronic
957087209 3:75692247-75692269 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
958803802 3:98785571-98785593 CAGTGAAGCTGGAAAGTAGCAGG + Intronic
959565087 3:107825824-107825846 GAGTGACACAGCACAGTGGAAGG + Intergenic
959790116 3:110349657-110349679 CAGTTACACTGGAAAATCAAAGG + Intergenic
960693227 3:120369317-120369339 CAGGGATACAGGAAAGTAGAAGG - Intergenic
961193992 3:124986071-124986093 CAGAGAAACTGGAAAGGGCAAGG - Intronic
961331245 3:126140635-126140657 CAGTAACACTATAAAGGGGAAGG + Intronic
961508580 3:127387756-127387778 AAGTGACACTGGCAGGTGGGTGG - Intergenic
967724323 3:192847363-192847385 CAGAGACAGTGGAAAGAGAATGG + Intronic
967979528 3:195057519-195057541 CAGAGACACAGGAGAGTGGGAGG - Intergenic
968058742 3:195712692-195712714 CAGTGGCACTAGAAAGGGGATGG - Intergenic
968770578 4:2503373-2503395 GAGCTACCCTGGAAAGTGGATGG + Intronic
969082686 4:4631919-4631941 CTGTGCCACTGGAATGTGAATGG + Intergenic
969703031 4:8778056-8778078 CAGTGTGATTGGAAAGTGAATGG + Intergenic
970302743 4:14698759-14698781 GAGTGAATCTGTAAAGTGGATGG + Intergenic
970635647 4:18006595-18006617 CAGTCATAGTGGAAAGTGAAAGG + Intronic
970754671 4:19411106-19411128 CAGTGATAGTGAAAAGTGCAAGG - Intergenic
971755002 4:30696114-30696136 AAATAACACTGGAAAGTGAAGGG + Intergenic
974156846 4:58084278-58084300 CACTCACAGTGGAAAGTGAAAGG - Intergenic
974723077 4:65767297-65767319 CAGTGACACTGCAAAGCAGTGGG - Intergenic
976195782 4:82530033-82530055 CTGAGACACAGGAAAGTGAAAGG + Intronic
978260810 4:106755964-106755986 AAGTGACACTGGAATTTTGATGG + Intergenic
978474611 4:109111685-109111707 TAATGACTCTGGAAAGGGGAAGG - Intronic
979757433 4:124359485-124359507 CATTGACACAGGAAAGGGAATGG - Intergenic
981644549 4:146984406-146984428 CAGGGACACTAGTAATTGGAAGG + Intergenic
981974429 4:150707660-150707682 CTATGACACTGAACAGTGGAAGG + Intronic
983156839 4:164358299-164358321 CAGTGACATTGGCAAGTTCAAGG - Intronic
984403172 4:179293111-179293133 CCATGACACTGTAAAGTGAATGG - Intergenic
985331865 4:188846061-188846083 CACTTATGCTGGAAAGTGGAAGG - Intergenic
985851893 5:2394595-2394617 CAGTTCCTCTGGAAAGAGGATGG - Intergenic
986251166 5:6059725-6059747 CACTGGCACTGGGAAATGGATGG + Intergenic
986869424 5:12029556-12029578 TACTGACACTGGAAAGTGGTTGG + Intergenic
987121054 5:14767071-14767093 CAATGACATAGGAAAGTGGTGGG + Intronic
987993162 5:25241665-25241687 CACTGAGACTGGGAAGTGGGAGG + Intergenic
988458750 5:31413096-31413118 CCCTGACACTGGAAGGTGGCAGG - Intronic
990742845 5:58929896-58929918 CAGTGACACTGGAAATGTCAGGG - Intergenic
991169431 5:63604025-63604047 CAGTGACAGTGGACTGGGGAGGG - Intergenic
992332827 5:75735089-75735111 CAGTGACACAAGAATGAGGACGG - Intergenic
994067951 5:95564564-95564586 CAGCTAAACTGGAAAGGGGAAGG - Intronic
994813862 5:104557986-104558008 CAATCACAGTGGAAAGTGAAGGG + Intergenic
995803339 5:116023588-116023610 CACTGGCACTGGGAAGGGGAAGG + Intronic
997136117 5:131328243-131328265 AAGTGACACTGGACACAGGATGG - Intronic
998479377 5:142449255-142449277 CAGGGAGAGTGGAAAGTTGAGGG + Intergenic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
999477052 5:151910031-151910053 AAATGTCACTGGAAAATGGAAGG - Intronic
1001710920 5:173777360-173777382 CAGAGACACTGGAAAGTGCCAGG + Intergenic
1005774324 6:29114108-29114130 AAGTCACACTAGAAATTGGAGGG - Intergenic
1005780221 6:29183718-29183740 AAGTCACACTAGAAATTGGAGGG - Intergenic
1005993608 6:30918734-30918756 CAGTAGAACTGGAAAGGGGAAGG - Intronic
1006106562 6:31720363-31720385 CAGGGAAAATGGAAAGTGGGCGG + Intronic
1006565118 6:34949559-34949581 CAGTGACTTTGGAAATAGGAAGG + Intronic
1010294562 6:74181555-74181577 CTCTGACACTGGAAAGTGAGTGG + Intergenic
1010910398 6:81548222-81548244 CATTCACAATGGAAAATGGAAGG - Intronic
1011695887 6:89912360-89912382 AAGGGACACTGGGAAGTAGATGG + Intergenic
1011774053 6:90708366-90708388 CAGGGACTCTGGAAAGTGAAAGG + Intergenic
1012991316 6:105929451-105929473 CAGAGACACAGAAAAGTAGAAGG + Intergenic
1013384492 6:109611658-109611680 CAGGAACACTGGAAAGGGAAAGG - Intronic
1014981966 6:127955526-127955548 CAGTGTTACTGGAACCTGGAGGG + Intergenic
1014989876 6:128061527-128061549 AACTGACACTGGAAAGGGGGTGG + Intronic
1015055392 6:128896426-128896448 CAGTGTTACTGGAATGTGTATGG - Intronic
1016079270 6:139835822-139835844 CAGGGTCATTGGAAAGTAGATGG - Intergenic
1016105635 6:140158772-140158794 CAGTGACATTGGGAATTGGCTGG + Intergenic
1016579045 6:145607549-145607571 CAATGACAGTGGAAACTGGAAGG + Intronic
1018360312 6:163061290-163061312 CAGGTACCCTGGACAGTGGAGGG + Intronic
1019194371 6:170272648-170272670 CAGTGATCATGGAAGGTGGAAGG - Intergenic
1020019154 7:4852184-4852206 CAGAGACACTGAAAAATGAAGGG + Intronic
1020654763 7:10916265-10916287 AACAGACACTGGGAAGTGGAGGG + Intergenic
1020806910 7:12801405-12801427 CATGGACACTGAAAAGTGGCTGG + Intergenic
1021704469 7:23353098-23353120 GAGTGACACTGGGAAGTGTGGGG - Intronic
1023552104 7:41381420-41381442 CAGTGACGCTGTAAAGTAAATGG - Intergenic
1024300225 7:47881866-47881888 CAGAAACACTGCAAATTGGAGGG + Intronic
1024798631 7:53049982-53050004 CAGTGACACAGGAAAATGAATGG - Intergenic
1026634436 7:72069122-72069144 AAGTGACACTGCAAAGTGGCTGG + Intronic
1026949334 7:74337190-74337212 CACAGACCCCGGAAAGTGGAAGG - Intronic
1027340231 7:77199653-77199675 CAGTGAGACTAGAAAGCAGAGGG - Exonic
1029372918 7:100160587-100160609 CAGTAACAGTGGAAACAGGATGG + Exonic
1030085901 7:105815475-105815497 TAGTAACACTGGAAGCTGGAAGG + Intronic
1030324575 7:108205580-108205602 CAGTGAAACTGACAAGTGGAAGG - Intronic
1031404253 7:121364811-121364833 CAATGACACTGTAAAATGGAAGG + Intronic
1033588640 7:142792609-142792631 CACAGACACTGGAGGGTGGAGGG + Intergenic
1033709354 7:143924902-143924924 CATTGACAATGTAGAGTGGACGG - Intergenic
1033714072 7:143981398-143981420 CCGTGACACAGGAAGCTGGAAGG - Intergenic
1033804530 7:144938513-144938535 GAATGACAGTTGAAAGTGGAAGG + Intergenic
1035766742 8:2112482-2112504 TAGCGACACAGGGAAGTGGAGGG + Intronic
1035864474 8:3067866-3067888 CAGTGACCCCTGAAAATGGAGGG - Intronic
1035987571 8:4451531-4451553 CAGTGACTCTGGAAAGGTAAAGG + Intronic
1036664061 8:10727451-10727473 TAGAGACTCTGGAAAGTGCAGGG - Intronic
1037312580 8:17572450-17572472 CAGAGACAGTTGAAAGAGGAGGG + Intergenic
1037894449 8:22642394-22642416 CAGTGCCTCTGGGGAGTGGAGGG + Intronic
1038298387 8:26318217-26318239 CAGTAACACTGGAAGGAGGAAGG - Intronic
1038328575 8:26590456-26590478 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328585 8:26590516-26590538 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328595 8:26590576-26590598 CAGTGACACCTGAGGGTGGATGG - Intronic
1038328605 8:26590636-26590658 CAGTGACACCTGAGGGTGGATGG - Intronic
1039028340 8:33282610-33282632 CACTTATAGTGGAAAGTGGAAGG + Intergenic
1039039124 8:33390239-33390261 CAGTGTCACTGCAAAGTGCCTGG + Intronic
1040739326 8:50553701-50553723 AAGAGACACAGGAATGTGGAAGG - Intronic
1043774218 8:84244492-84244514 AAGTGACATTGAAAACTGGAAGG - Intronic
1044942084 8:97353770-97353792 CAGTCACATTGGAAAGTCGTGGG - Intergenic
1045597429 8:103672490-103672512 CAGTCACAGTGGAAGGTGAAGGG + Intronic
1045685265 8:104704963-104704985 CAGTGACACAAGAAATAGGAGGG - Intronic
1046773437 8:118138942-118138964 TAATGAGATTGGAAAGTGGAAGG - Intergenic
1046834593 8:118785910-118785932 AAGTGACACTGTAATTTGGAGGG - Intergenic
1047412533 8:124636006-124636028 CATTCACACTGGAGGGTGGAGGG + Intronic
1047683855 8:127283589-127283611 CAGAAAGACTGGAATGTGGATGG + Intergenic
1047836138 8:128695310-128695332 CACTGACACTGTAATGAGGATGG + Intergenic
1048026323 8:130590340-130590362 CAGTTACACTGGAACATGAAGGG - Intergenic
1049515262 8:143051135-143051157 CAGTGACATTGGGAAATGCAAGG + Intronic
1051715299 9:19976480-19976502 CAGTCACAGTAGAAGGTGGAGGG - Intergenic
1051738580 9:20228863-20228885 CACAGACACTGGTAAATGGAGGG + Intergenic
1051866780 9:21692490-21692512 AAGTGCCACAGGATAGTGGAAGG + Intergenic
1052363431 9:27585188-27585210 CAGTGAGACTGGAAAGGGATTGG - Intergenic
1053750661 9:41251267-41251289 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054256172 9:62815610-62815632 CAGAGCCAGTGGAATGTGGAGGG + Intergenic
1054335132 9:63800004-63800026 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1055299081 9:74864367-74864389 AGCTGACACTTGAAAGTGGATGG - Intronic
1055727154 9:79242867-79242889 CAGTGACACTGACATGTGGAAGG - Intergenic
1056046255 9:82720193-82720215 CAATCACAGTGGAAAGTGAAAGG + Intergenic
1056667238 9:88590469-88590491 GAGTGGAACTGGAAAGGGGATGG - Intergenic
1057841761 9:98491310-98491332 AAGTGACACTGAAAGGTTGAAGG - Intronic
1059114235 9:111586508-111586530 CAACGATTCTGGAAAGTGGAAGG - Intronic
1059143500 9:111876263-111876285 AAGTGAGAGTGGAAAGTGAAGGG - Intergenic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1059669005 9:116475878-116475900 GAGTGTAACTGGAATGTGGAAGG - Intronic
1060141119 9:121211130-121211152 CAGAGACACAGAAAATTGGAAGG + Intronic
1060987376 9:127827501-127827523 GAGTGACTCTGGAAAGCTGAAGG + Intronic
1061136171 9:128735186-128735208 CACAAACGCTGGAAAGTGGAGGG + Intronic
1061401833 9:130372763-130372785 CAGGGACAATCGAAAGTGGAAGG + Intronic
1061849503 9:133406158-133406180 CAGTGGCACTGACAAGGGGACGG - Exonic
1061974083 9:134059632-134059654 CAGGGACCCTGGACACTGGAGGG + Intronic
1203371400 Un_KI270442v1:308973-308995 CAGAGCCAGTGGAATGTGGAGGG - Intergenic
1186812896 X:13207636-13207658 CACTGAATCTGGAAAGTGGGGGG - Intergenic
1187770615 X:22691814-22691836 TAGTGGCATTGGAAAGGGGAAGG - Intergenic
1188981887 X:36734074-36734096 AAGGACCACTGGAAAGTGGATGG - Intergenic
1189178400 X:38980835-38980857 CAGTGACACAGGCAGGAGGAGGG - Intergenic
1189206738 X:39246395-39246417 TAATGACACTTAAAAGTGGAGGG + Intergenic
1189237662 X:39500460-39500482 AAGGGATACTGGAAAGTGAATGG - Intergenic
1189958163 X:46297998-46298020 AAGTGACACTGGAAATTCCAAGG - Intergenic
1190114105 X:47614512-47614534 CAGGGACACTTGAAAGAGCACGG - Intronic
1191626991 X:63280335-63280357 CAGGGACACAGGAAAGGAGAAGG - Intergenic
1193394962 X:80972548-80972570 CAGTGATTCTGCAAAGTTGATGG - Intergenic
1194163910 X:90490025-90490047 CAGTCATAATGGAAAGTGAAGGG + Intergenic
1194598518 X:95889908-95889930 CTGTGGCACTGGAAAGAGAATGG + Intergenic
1196653137 X:118189047-118189069 CAGTGACACAGAGAAGAGGAAGG - Intergenic
1196735757 X:118979627-118979649 CAGGGACATTAGAAAGAGGAAGG + Intronic
1197433794 X:126400317-126400339 CTGTGACATTGGAAACTGCATGG + Intergenic
1197461889 X:126752854-126752876 CAGGAACACTGGAAGGTAGACGG + Intergenic
1199564672 X:149202624-149202646 CATTGATAATGTAAAGTGGAGGG - Intergenic
1199684819 X:150256512-150256534 CAGTGCCAGTGGGAATTGGAAGG + Intergenic
1199738155 X:150704653-150704675 CACTGACACTGCAGAGTGGAGGG - Intronic
1200044227 X:153392512-153392534 CAGTGGCAGAGGAAAGTGGGAGG + Intergenic
1201066944 Y:10106110-10106132 CAGAGCCAGTGGAATGTGGAGGG + Intergenic