ID: 910571329

View in Genome Browser
Species Human (GRCh38)
Location 1:88707789-88707811
Sequence CTGGTTAGAAAAATATGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910571329 Original CRISPR CTGGTTAGAAAAATATGACC AGG (reversed) Intronic
903797488 1:25940721-25940743 CTGTTTAAAAAAAAATTACCAGG + Intergenic
905616304 1:39402567-39402589 CTGGCTAGAAAGATAGCACCAGG + Intronic
906765748 1:48430982-48431004 ATGGATAAAAACATATGACCTGG + Intronic
909866304 1:80676596-80676618 TTGGTTAGGAAAAGATCACCAGG + Intergenic
910163171 1:84295953-84295975 CTGGCTAGAAAAATCTTACATGG + Intergenic
910571329 1:88707789-88707811 CTGGTTAGAAAAATATGACCAGG - Intronic
912984684 1:114415648-114415670 CTGTTTAGAAAACTGTCACCCGG + Intronic
913071663 1:115304467-115304489 CTGGTTTTAAAAATATGGCCAGG - Intronic
914368189 1:146999832-146999854 CTGGTAAGAATAATATGCCTGGG + Intergenic
914374163 1:147058557-147058579 CTGGTAAGAATAATATGCCTGGG + Intergenic
915428181 1:155844406-155844428 CTGGTTACATATATATAACCAGG + Intronic
916470464 1:165118098-165118120 CTGCTTAGGAAAATATGGGCTGG + Intergenic
916549061 1:165832062-165832084 CTGTGTAGAAAAATAAGGCCGGG - Intronic
918582081 1:186143367-186143389 CTGAAAACAAAAATATGACCTGG + Intronic
922063068 1:222110021-222110043 CTGGTTAGATACATCTGCCCTGG + Intergenic
1063877852 10:10498529-10498551 CTGGTTAGAGAAATGGGACCAGG + Intergenic
1064669622 10:17697950-17697972 CTGGAAATAAAAAGATGACCAGG - Intronic
1065788560 10:29239052-29239074 CTGGTTATTAAAATATCACAAGG - Intergenic
1066261861 10:33737113-33737135 CTGGACAGAAAAAGATGAACAGG + Intergenic
1067508467 10:46876155-46876177 CAGGTGAGAAAAGTATGACCTGG - Intergenic
1067653782 10:48175694-48175716 CAGGTGAGAAAAGTATGACCTGG + Intronic
1068381780 10:56263293-56263315 CTGGATAGAAAATTATGAAGAGG + Intergenic
1070338471 10:75475424-75475446 CTGGTTAGGAAAATTGGAGCAGG - Intronic
1071152414 10:82651163-82651185 TTGGTTAGAAGAAGATGACATGG + Intronic
1071593378 10:86897900-86897922 CAGGTTAAAAAAAGATGAACTGG - Intronic
1073416579 10:103388348-103388370 CTGCTTGGAAAAATCTGAACAGG + Exonic
1073785707 10:106886938-106886960 ATGTTTAGAAAAAGAAGACCAGG + Intronic
1073837646 10:107463347-107463369 GTGGTTATAGAAATCTGACCAGG - Intergenic
1074419965 10:113299924-113299946 CTGGTTAGACAACAATGACCTGG - Intergenic
1077948432 11:6927503-6927525 ATGGTTAGACTAATATAACCAGG - Intronic
1078283429 11:9925850-9925872 CTGTTTAGAAAATTATGGCAGGG + Intronic
1078619207 11:12892228-12892250 TTGGTTTGGAAAATGTGACCAGG + Intronic
1081449376 11:43157396-43157418 GTGGTAAGAAAAATATCACTGGG + Intergenic
1081758664 11:45562032-45562054 AAGGAGAGAAAAATATGACCTGG + Intergenic
1083539101 11:63499451-63499473 ATGGTGAGAAAATTATGACAGGG + Intergenic
1084953702 11:72680327-72680349 CTTCTTAGAAAAATATCCCCTGG + Intergenic
1086069580 11:82786116-82786138 ATGGTTAGAAAAATAGGCTCAGG + Intergenic
1086496437 11:87409275-87409297 CTGGTAAGGAATATTTGACCAGG + Intergenic
1087252636 11:95920526-95920548 CTGGTTAGGAAACTACTACCTGG + Intronic
1090436443 11:126690488-126690510 CTGGTTGGGAAAATGTTACCTGG + Intronic
1090554987 11:127864499-127864521 CTGGTTAGAAATATGTAGCCAGG - Intergenic
1090853505 11:130591600-130591622 CTGGCTTCAAAAATATGACAAGG - Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1093563449 12:20572333-20572355 TGAGTTATAAAAATATGACCTGG + Intronic
1095608045 12:44093860-44093882 CTGTTTAAAGAAATATGAACTGG + Intronic
1096447397 12:51705874-51705896 CTGGGAAGAAAAAAGTGACCAGG + Intronic
1097692391 12:62745678-62745700 CTTCTTAGAAAAATAAGAACTGG + Intronic
1099641662 12:85296482-85296504 TTGGTTAGAAAAACATGAAGGGG + Intronic
1100148506 12:91707206-91707228 CTGGTTAGAACAATGTGGCATGG + Intergenic
1101939285 12:109088009-109088031 TTTGTTAGAAAAAAATCACCTGG + Exonic
1106481781 13:30142444-30142466 ATGGTTAGAAAAAAAGGATCTGG - Intergenic
1110075266 13:71232389-71232411 GTGTTTAGAAAAAAATGAACAGG + Intergenic
1110500070 13:76216975-76216997 TTGGAAAGAAAAATATTACCAGG + Intergenic
1110667367 13:78133674-78133696 CTGGTGATAACAATATGCCCCGG - Intergenic
1110737302 13:78952217-78952239 CTGGTTAGAAAATTCTGATTTGG + Intergenic
1111000141 13:82167592-82167614 CTGGTTTGGAAAATATGCCAAGG + Intergenic
1112803250 13:103135136-103135158 CTGGTTACAACAATATGAAACGG + Intergenic
1115796337 14:36940566-36940588 TTATTTAGAAAAAAATGACCAGG - Intronic
1116161334 14:41269759-41269781 CTGGTTACATAGATATAACCAGG + Intergenic
1116322123 14:43481289-43481311 CTGCTTAGAATGAAATGACCTGG - Intergenic
1116942218 14:50801814-50801836 CTCATTAGAAAAATAGGACCAGG - Intronic
1120566090 14:86059184-86059206 CTTATTGGAAAAATCTGACCTGG - Intergenic
1124056864 15:26249164-26249186 CTGTTTAGAAAAATTTGAGAAGG + Intergenic
1125739434 15:41951900-41951922 CAGGTTGGAAAAAAATCACCTGG + Intronic
1126013588 15:44327801-44327823 CTGGATAGTAAATTATAACCTGG - Intronic
1126754862 15:51916179-51916201 CTTGTTAGGACAATCTGACCTGG + Intronic
1126900779 15:53312308-53312330 CTGATTAGAAAGATAGGACAAGG - Intergenic
1130892379 15:88144214-88144236 CAGGTTGGAAAAATTTGACGTGG - Intronic
1131809537 15:96158498-96158520 GTGGATAGAAAAAAATGGCCGGG + Intergenic
1133150803 16:3828052-3828074 CTGGCTAGAAAAATGTGCCTTGG - Intronic
1139235078 16:65329306-65329328 CTGGTTAGAAAAACAAAACAGGG + Intergenic
1139756785 16:69150468-69150490 CTGGTTGGAAAAATATTCCGAGG - Intronic
1140039521 16:71396884-71396906 CTGTGGAGAAAAATATGGCCGGG - Intergenic
1141389155 16:83649867-83649889 CTGGTTAGAAAGGTACAACCTGG - Intronic
1144221220 17:13101588-13101610 CAGGTTATCAAAAAATGACCAGG + Intergenic
1147434459 17:40400025-40400047 CTGTTTAAAGAAATATGACACGG - Exonic
1149208898 17:54280926-54280948 CTGATGAGGAAATTATGACCTGG - Intergenic
1157046078 18:44103392-44103414 CTGGTTACATACATATGACCAGG - Intergenic
1159183632 18:64943164-64943186 CTGGTTACATAGATATAACCAGG - Intergenic
1160991274 19:1861288-1861310 CTGGCAAGAAAAGAATGACCTGG + Intronic
1165131077 19:33632453-33632475 CTGCTTAGAAAAAAATGATTTGG - Intronic
1168620923 19:57879011-57879033 GTGGTTATACCAATATGACCAGG + Intronic
925551746 2:5083911-5083933 CAGGTTGGAAAAAAAGGACCAGG - Intergenic
926543458 2:14209322-14209344 CTCGCTAGAAAAATCTTACCTGG + Intergenic
927667859 2:25044623-25044645 CTCATTAGAAAAATACCACCAGG + Intronic
929465827 2:42142953-42142975 TTGGTTATACAACTATGACCTGG + Intergenic
930113568 2:47699507-47699529 CTGGTTATAAGGATATGACCAGG + Intronic
931169279 2:59785621-59785643 CTGGGTAGAACAATATTCCCAGG - Intergenic
931472688 2:62555047-62555069 CATGTTAGAAAAACATCACCAGG + Intergenic
932381586 2:71288524-71288546 TTGGTTAAAAAAAAATGTCCTGG + Intronic
935672905 2:105570806-105570828 ATGGGTAGAAAAATAAGGCCAGG - Intergenic
936073526 2:109386973-109386995 CTGATTATAAAAATAATACCTGG + Intronic
937140454 2:119595748-119595770 GTGGTGAGAAAAATAAGACATGG + Intronic
939291842 2:140205942-140205964 GTGTTTAGAAAAAGATGATCTGG - Intergenic
939536198 2:143432650-143432672 CTGGTAAGAAATTTATGCCCAGG - Intronic
939834878 2:147117780-147117802 CTGGTTGGAAAAAATTGACATGG - Intergenic
939992137 2:148885936-148885958 CTGCTTGGCAAAATAAGACCTGG - Intronic
940844362 2:158623821-158623843 CAGGTTAGAAGACTAGGACCAGG - Intronic
942284457 2:174401044-174401066 CTTACTAGAAAAATATGGCCAGG + Exonic
943438706 2:187899492-187899514 CTGGGTAGAAAAAAAAGAACAGG - Intergenic
943707367 2:191049512-191049534 CTGCTAAGAAAAATATGACTGGG + Intronic
944870053 2:203901295-203901317 CAGGTTAAAAAAATAAAACCTGG - Intergenic
945190505 2:207182647-207182669 CAAGTAAGAAAAATTTGACCAGG - Intergenic
1172903864 20:38354785-38354807 TTGATTAGAAAAGTGTGACCGGG + Intronic
1173287892 20:41689471-41689493 CTTTTTAGAAAAATAAGCCCTGG - Intergenic
1173436977 20:43042337-43042359 CTGGTTAGTAAATTATCGCCTGG - Intronic
1173469928 20:43315281-43315303 CTGGCTAAAAAAATATGAGTAGG - Intergenic
1175907803 20:62390119-62390141 TTGCTTAGAAAAATAAGAGCCGG + Exonic
1177162797 21:17566545-17566567 CTAATAAGAAAAATATCACCTGG - Exonic
1177707844 21:24732100-24732122 ATGGTTAGAATTATATTACCTGG - Intergenic
1177982602 21:27932906-27932928 CTGGTTGGTGAAATATTACCTGG + Intergenic
1181548565 22:23621033-23621055 CTTGGTATAAAAATATGACAAGG - Intronic
1182964724 22:34510298-34510320 CTGGTTACATAGATATAACCAGG + Intergenic
1184781292 22:46650969-46650991 CTGGGCAGAAAAATATGTCGAGG - Intronic
1185009253 22:48304070-48304092 CTGGTTTTAAAAATATAAACAGG - Intergenic
1185022124 22:48382781-48382803 CAGGTTACATAAATAGGACCTGG - Intergenic
950244573 3:11404435-11404457 CTGGTTAAAAAAATTTGAGCTGG - Intronic
950273418 3:11638482-11638504 TTGGTTAGTAAAACATGCCCAGG - Intronic
951106374 3:18748049-18748071 TTGGTTGTAAAAATATGTCCAGG + Intergenic
951383031 3:22008655-22008677 GTGGTTAGAAAAGCATGGCCCGG - Intronic
951757293 3:26105020-26105042 CAGGCTAAAAATATATGACCAGG - Intergenic
955442981 3:58977055-58977077 CTGGTCACAAAAATATCACCAGG - Intronic
956645254 3:71448846-71448868 CTGCTTAGCAAACTTTGACCTGG + Intronic
956887339 3:73573444-73573466 GTGGTGGGACAAATATGACCTGG - Intronic
956977701 3:74600807-74600829 CTGGTTGAAAAAATCTGGCCTGG - Intergenic
957876713 3:86156217-86156239 CTGGGTACAAAGATATGAGCTGG + Intergenic
959312228 3:104753802-104753824 AAGGTTAGAAAAATATGAGGGGG - Intergenic
959511907 3:107223140-107223162 CTCATTAGGAAAATATGACTTGG - Intergenic
961106777 3:124249372-124249394 CTGGTGGTAAAAATCTGACCTGG + Intronic
961223264 3:125216905-125216927 TTGTATAGAAAAATATGGCCGGG + Intergenic
961685035 3:128624187-128624209 TTGATTATAAAAATCTGACCAGG + Intronic
961848686 3:129792980-129793002 CTAATTAGAAAATTATCACCTGG + Intronic
963728752 3:148950155-148950177 TATGTTAGAAAAATATGGCCGGG - Intergenic
966017803 3:175164626-175164648 CTGGATAGAAAAATATTAACTGG + Intronic
966219426 3:177535792-177535814 CTGGTGAGAGAAATATGAACAGG + Intergenic
966792326 3:183685138-183685160 CTGTTTAAAAAAAAATGACCTGG + Intergenic
967363969 3:188664789-188664811 CTAGGTATAAAAATATTACCAGG + Intronic
970726420 4:19050571-19050593 CTGCTTTGAAATATATGAGCTGG + Intergenic
973084548 4:46040043-46040065 GTGGTTAAAAAATTATTACCTGG - Exonic
973188803 4:47363530-47363552 CTGGTATTATAAATATGACCTGG - Intronic
973254544 4:48096161-48096183 TTGGTTAAAACAATTTGACCAGG - Intronic
976239205 4:82935581-82935603 CTTCTTAGAAATATATGGCCGGG - Intronic
977919916 4:102631727-102631749 CTGGTTACAAGAATGTGACATGG - Intronic
978166925 4:105620587-105620609 CTTGTTTGAAAAACATGATCAGG - Intronic
979022996 4:115526102-115526124 CTGGGTTTGAAAATATGACCTGG + Intergenic
979097530 4:116569957-116569979 ATGGGCACAAAAATATGACCAGG + Intergenic
981180474 4:141736662-141736684 CTGGTAAGAAAAGTATCAACTGG + Intergenic
981913079 4:150004732-150004754 TGGGTTAAAAAAATATGAGCAGG - Intergenic
983482606 4:168293363-168293385 TTGGTTTGAAAAATGTTACCTGG + Intronic
986997573 5:13624857-13624879 CTGGCTAGAAACATGTGTCCAGG - Intergenic
987609371 5:20182080-20182102 CTGGGAAGAAAAATTTGAACTGG + Intronic
987619548 5:20323022-20323044 CAGGTTAAAATGATATGACCTGG + Intronic
987701446 5:21405097-21405119 CTAGTTAGATAGACATGACCAGG + Intergenic
988812622 5:34800644-34800666 CTCGTTAGAAAAACATCACAGGG + Intronic
990118199 5:52415257-52415279 CTGGTTAGAAAAATAGAACGAGG + Intergenic
991453236 5:66775216-66775238 ATGGCTAGAAGAAAATGACCTGG + Intronic
996387942 5:122928494-122928516 TAGGTTAGAGAAATATGACAAGG + Intronic
1000039678 5:157476024-157476046 GAGGTTAGAAAAATATAATCAGG + Intronic
1003096861 6:3149184-3149206 CTGGTTAGACAAAACTGTCCTGG + Intronic
1003335856 6:5171552-5171574 CTGCTTATAAAAATATTTCCTGG - Intronic
1007003504 6:38337009-38337031 CTGGTTAGAGAAATAGGACTTGG + Intronic
1009357083 6:62763858-62763880 CAGTTTTGAAAAATGTGACCAGG + Intergenic
1009589149 6:65643428-65643450 CTGGTTAGAGAAAGACCACCGGG - Intronic
1010106734 6:72179213-72179235 CTGATTAGAAAAATGTTACCAGG - Intronic
1010723152 6:79306711-79306733 CTGGTTAGACACAGACGACCAGG - Intergenic
1012111489 6:95241195-95241217 CAGGATAGAAAAAAATGACATGG + Intergenic
1012358204 6:98342694-98342716 CTGGGGAGAAAAAAATGACTTGG + Intergenic
1012827868 6:104168529-104168551 CTGACTAGAAAAATATTAACTGG - Intergenic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1014592847 6:123294231-123294253 CTGGTTACATAGATATAACCAGG + Intronic
1014790239 6:125664205-125664227 CTGATTATAAAAATATGTCTAGG + Intergenic
1015348501 6:132188684-132188706 CTATTTAGAAAAATAAGACAAGG - Intergenic
1016661141 6:146582235-146582257 CTGGAGAGAAAAACATGACCTGG + Intergenic
1018732569 6:166663511-166663533 CTGGATAGAAAAATATAAACAGG + Intronic
1022895333 7:34744923-34744945 TTGTTTAGAAAATTATGACAAGG - Intronic
1023572927 7:41591319-41591341 CTGGTTAGGAAAATACATCCTGG - Intergenic
1024022838 7:45387196-45387218 CTGGTTAGATAAAAATTATCAGG + Intergenic
1027004525 7:74681536-74681558 CTGGTCAGAACAAGATGACACGG - Intronic
1027797276 7:82711136-82711158 CTGGTTACATAGATATAACCAGG - Intergenic
1028708735 7:93882667-93882689 CTGGAAAAAAAAATATGATCAGG - Intronic
1029941716 7:104487833-104487855 TTGTCTAGAAAAATATTACCAGG - Intronic
1030480979 7:110103331-110103353 CTGGACAGAAAAATATTAACAGG + Intergenic
1031327353 7:120418334-120418356 CAGGTTAGAAAAATGTGAAAGGG - Intronic
1031417977 7:121516169-121516191 ATGGCTAGAAAGATATGGCCAGG - Intergenic
1032134381 7:129262246-129262268 AGGGTTAGAAAAATAAGACAGGG + Intronic
1033956517 7:146855987-146856009 CTAGTTAGAAAAATTTTACCAGG + Intronic
1034750763 7:153566865-153566887 CTTTTTTGAAAAATATGGCCAGG + Intergenic
1034751774 7:153575744-153575766 ACAGTTTGAAAAATATGACCTGG + Intergenic
1035041343 7:155930119-155930141 ATTGTTATAAAAATATTACCAGG + Intergenic
1036143752 8:6233052-6233074 CAAGTAAGAAAAATATGCCCAGG + Intergenic
1036197464 8:6732662-6732684 CTGGTAAGAAAAATAAAAACGGG - Intronic
1036994109 8:13634428-13634450 CTGCTTAGTTAAATATGAGCAGG + Intergenic
1037660569 8:20922969-20922991 CTGGTTAAATAAGAATGACCAGG + Intergenic
1039243064 8:35577927-35577949 ATCCTTAGAAAAATGTGACCTGG + Intronic
1040446311 8:47498562-47498584 CTGACTATAAAAATAGGACCAGG + Intronic
1042519458 8:69695885-69695907 CTGCTAAGAAAAACAAGACCAGG + Intronic
1043358220 8:79439097-79439119 CTGGGCAGAAAAATATGCCAAGG + Intergenic
1043374030 8:79627291-79627313 CTGCATAGATAAATATGACTTGG - Intronic
1044173513 8:89087173-89087195 CTGTTTGGAAAAATATTCCCTGG + Intergenic
1046746602 8:117882671-117882693 CTGGGTATAAAAATATGATATGG + Intronic
1047390575 8:124447396-124447418 TTGGTTAGAAAAATATGCCATGG + Intergenic
1047641154 8:126822921-126822943 GTGGTTAAAAAATTATGAGCTGG + Intergenic
1050046356 9:1550377-1550399 ATGGGTACAAATATATGACCAGG + Intergenic
1050991984 9:12167250-12167272 CTGGTTACATAGATATAACCAGG - Intergenic
1051265450 9:15305248-15305270 CTGATTAGGGAGATATGACCTGG - Intronic
1055870505 9:80872763-80872785 AAGGTTAGCAAAATATCACCTGG + Intergenic
1057048515 9:91904206-91904228 GTGGTTAAAAAAGGATGACCTGG - Intronic
1058415330 9:104782558-104782580 CTGACTAGAAAAATAAGACTGGG + Exonic
1059167698 9:112094724-112094746 CCAGTTAGAAAAATATGACAAGG + Intronic
1059168393 9:112100530-112100552 CTGGTTAAAAAAATTGTACCTGG + Intronic
1060085207 9:120693007-120693029 CTGGAAAGACAAATAAGACCTGG - Intronic
1061334269 9:129920594-129920616 ATGGTTAGAAAAAGATAAGCTGG - Intronic
1186448691 X:9654025-9654047 ATAGATAGAAAAATATGCCCAGG - Intronic
1187500503 X:19834529-19834551 TTGGGTAGAAAAAGATCACCTGG - Intronic
1189183764 X:39032380-39032402 CTGGATAGAAAAAAATGGACTGG - Intergenic
1190752706 X:53376058-53376080 CTGGTAAGCAAAATATCCCCAGG + Exonic
1195313178 X:103653715-103653737 CTGGTTACATAGATATAACCAGG - Intergenic
1195447545 X:104971451-104971473 CTGGTTACATAGATATAACCAGG - Intronic
1198272607 X:135068579-135068601 CTGGTTAGATAGATGTAACCAGG + Intergenic
1198324330 X:135553031-135553053 CTAGTTAGAAAAAAAGGAGCAGG + Intronic
1201928997 Y:19320563-19320585 CAGGTTAGGAAAAGTTGACCAGG + Intergenic
1202041163 Y:20685569-20685591 CTGGTTACATAGATATAACCAGG + Intergenic