ID: 910574687

View in Genome Browser
Species Human (GRCh38)
Location 1:88747528-88747550
Sequence ATCTTTCTCAAACGAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910574687_910574689 -4 Left 910574687 1:88747528-88747550 CCTGACACTCGTTTGAGAAAGAT 0: 1
1: 0
2: 1
3: 9
4: 109
Right 910574689 1:88747547-88747569 AGATCCGGTTTCCTGAATCTTGG 0: 1
1: 0
2: 1
3: 9
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910574687 Original CRISPR ATCTTTCTCAAACGAGTGTC AGG (reversed) Intronic
904484932 1:30818387-30818409 ATATTTCTCAAACGAATGAATGG - Intergenic
905133234 1:35777473-35777495 ATCTTTCTCAAGCATGTATCTGG - Intergenic
905614460 1:39385366-39385388 ATCTATCTAAAAGCAGTGTCAGG - Intronic
910574687 1:88747528-88747550 ATCTTTCTCAAACGAGTGTCAGG - Intronic
920366501 1:205450749-205450771 ATCTCTCTCTAAGGTGTGTCTGG + Intronic
921500387 1:215895284-215895306 ATCTTTCTATCACCAGTGTCTGG - Intronic
923288576 1:232521589-232521611 ATGATTGTCAACCGAGTGTCAGG - Intronic
923607377 1:235456769-235456791 ATCTTGCTCTAAAGAGTATCCGG + Intronic
1070955178 10:80459116-80459138 AGCTGTCTCACACCAGTGTCAGG - Intronic
1072571883 10:96665527-96665549 CTGTCTCTCAAACCAGTGTCTGG + Intronic
1074092665 10:110276628-110276650 TTCCTTCTCAAGCAAGTGTCTGG + Intronic
1085043242 11:73339041-73339063 ATCTTTGTCAAGAGAGTGCCTGG - Intronic
1087267891 11:96080936-96080958 AGTTTTCTCAAACGAGTCTCTGG - Intronic
1091257444 11:134202262-134202284 ATCTTTCCCAGACGACTGTTGGG - Intronic
1097423433 12:59411293-59411315 GTGTTTCTCAAAAGAGTGACAGG - Intergenic
1100684884 12:96976694-96976716 ATGTTTCTCAGACCAGTGTGTGG + Intergenic
1101003868 12:100382811-100382833 AATTTTCTCAAACCAGTGCCTGG - Intronic
1101061709 12:100979279-100979301 ATGGTTCTCAAACATGTGTCAGG + Intronic
1101656200 12:106722557-106722579 ATCTATCCCAAAAGAGTGTGTGG - Intronic
1105668688 13:22588595-22588617 ATCTTTCTCCACAGTGTGTCAGG - Intergenic
1105901006 13:24753053-24753075 TTCTTTCTTTAATGAGTGTCAGG + Intergenic
1107614282 13:42148602-42148624 ATCTTCCTAAAATGAGTATCTGG + Intronic
1108666026 13:52631487-52631509 TTCTTTCTCAACCGAACGTCCGG - Intergenic
1109858681 13:68169532-68169554 ATATTTCTCAAACGTGAGTAGGG + Intergenic
1117447184 14:55815432-55815454 ATGTTTCTCAAAGGAATGACAGG + Intergenic
1118321177 14:64754183-64754205 ACTTTCCTCATACGAGTGTCTGG - Intronic
1119896800 14:78226781-78226803 ATCTTTCTCTACCAAGTTTCAGG - Intergenic
1121524539 14:94610542-94610564 ATCTTTCTTAAATGACTTTCAGG - Intronic
1123451444 15:20364750-20364772 ATCTTGCTCAAAAGTGTGTTAGG - Intergenic
1126336107 15:47587955-47587977 ATCTCTCTGAAAAGAGTGGCTGG + Intronic
1135253073 16:20917329-20917351 ATCTTTCTAAAAAGTCTGTCTGG + Intronic
1138313920 16:56052070-56052092 CTCTTTCTAAAAAGAGTGACCGG + Intergenic
1143058288 17:4178870-4178892 GCCATTCTCAAACGAGAGTCCGG - Exonic
1149162881 17:53715928-53715950 ATCTTTCTAACAGGACTGTCAGG + Intergenic
1151500652 17:74486203-74486225 ATCTTTGTCAAACCAGAGACAGG + Intergenic
1162239449 19:9337421-9337443 ATCTTTCTCAAGAGAGTGCAGGG + Intronic
1165330562 19:35139366-35139388 ATCTTTCACAATCGGATGTCAGG - Intronic
1168041465 19:53762621-53762643 TTCTTTCTCAAGAGAGAGTCTGG + Intergenic
925054250 2:844095-844117 TTCTTTCTTCAACTAGTGTCAGG + Intergenic
925086467 2:1111769-1111791 ATCTTTCTCAAAGGACTGTAAGG - Intronic
925086496 2:1112004-1112026 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086510 2:1112145-1112167 ATCCTTCTCAAAGCAGTGTAAGG - Intronic
925086522 2:1112239-1112261 ATCCTTCTCAAACGACTGCAAGG - Intronic
925086548 2:1112521-1112543 ATCTTTCTGAAAGGACTGTAAGG - Intronic
925086552 2:1112568-1112590 ATCTTTCTCAAAGGACTGTAAGG - Intronic
925086581 2:1112803-1112825 ATCCTTCTCAAACGACTGCAAGG - Intronic
925086601 2:1113037-1113059 ATCTTTCTCAAAGGACTGTAAGG - Intronic
925086607 2:1113084-1113106 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086620 2:1113178-1113200 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086630 2:1113268-1113290 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086635 2:1113315-1113337 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086691 2:1113820-1113842 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086752 2:1114291-1114313 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086777 2:1114526-1114548 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086788 2:1114620-1114642 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086793 2:1114667-1114689 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086802 2:1114757-1114779 ATCCTTCTCAAAGGAGTATAAGG - Intronic
925086826 2:1114945-1114967 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086848 2:1115133-1115155 ATCCTCCTCAAACGACTGTAAGG - Intronic
925086853 2:1115180-1115202 ATCCTTCTCAAAGGACTGTAAGG - Intronic
925086874 2:1115360-1115382 ATCCTTCTCAAAGGACTGTAAGG - Intronic
934029380 2:88028457-88028479 ATCTTTCTGAAACAAGTCTTTGG + Exonic
936747560 2:115596877-115596899 TTCTTTTACAAAAGAGTGTCAGG + Intronic
936876522 2:117196346-117196368 ATTTTTCACAAATGAGTGTATGG + Intergenic
945039866 2:205734613-205734635 ATGTTTTTAAAACTAGTGTCAGG - Intronic
946320275 2:218949859-218949881 AGCTTTCTCAAAGGAGTGATTGG - Intergenic
1171532036 20:25859282-25859304 TTCTGTCCCAAACGAATGTCAGG - Intronic
1171532671 20:25862598-25862620 TTCCGTCTCAAACGAATGTCAGG - Intronic
1174692160 20:52516868-52516890 ATGTTTTACAAATGAGTGTCTGG + Intergenic
1176984251 21:15418218-15418240 AAATTTCTCAAACTTGTGTCTGG + Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
950705378 3:14776316-14776338 ATTTTTCCCAAACAACTGTCTGG - Intergenic
956232773 3:67035727-67035749 AACTTTCTCAAGCTGGTGTCAGG - Intergenic
959493573 3:107022088-107022110 AACTTTCTTAAAAGAGTTTCAGG + Intergenic
963952100 3:151214186-151214208 ATCCTACTCAATGGAGTGTCAGG - Exonic
964586409 3:158309777-158309799 ATCTTTCTCCTACCAGTTTCTGG + Intronic
965840999 3:172905410-172905432 ATCTCTCTCAGAAGAGTTTCTGG + Intronic
973117974 4:46485126-46485148 ATCTTTCTCACATGATTGTGTGG - Intergenic
974399517 4:61385450-61385472 CTCTTTCACAAACTAGTGTGTGG + Intronic
974611963 4:64229205-64229227 GTCTTTCTAAAAGGAGTCTCTGG - Intergenic
983372762 4:166883575-166883597 ATCTGTCTCAAACTTGTGTCTGG + Intronic
986999705 5:13647759-13647781 AGAGTTCTCAAACCAGTGTCTGG + Intergenic
989025965 5:37068831-37068853 CTCTTTCTGAAACAAGTCTCAGG + Intergenic
989269463 5:39515062-39515084 ATCTTCCTCAAAGGATTGTTGGG - Intergenic
989763854 5:45054431-45054453 ATCTTTCTAATACGTGAGTCTGG + Intergenic
989990030 5:50752143-50752165 ATCTTTATCAAACTATTGTTTGG + Intronic
991511152 5:67377734-67377756 GTCTTTCTCACATGAGTTTCTGG + Intergenic
995799569 5:115979285-115979307 ATCTTTCTCAAAAGTGAGTTGGG + Intronic
999073871 5:148776807-148776829 ATCTTTCTTAAATGTGTGTATGG - Intergenic
1000274453 5:159721006-159721028 ATATTTCTCAATCATGTGTCTGG + Intergenic
1006861672 6:37175569-37175591 ATCTTCCTGAAACGAATGTATGG + Intergenic
1008269396 6:49473024-49473046 ATGTTTCTCAAATAAGTTTCAGG + Intronic
1011943832 6:92876077-92876099 ATCTTGCTCAAATGGGTCTCAGG + Intergenic
1017525921 6:155241267-155241289 ATCTTTCTCAAACCACTGACTGG - Intronic
1023591619 7:41786615-41786637 ATCTTTCTCAATGGACTTTCAGG + Intergenic
1025791281 7:64689283-64689305 TACTTTCTCAAACCAGAGTCTGG - Intronic
1030669100 7:112315174-112315196 ATCTTCCTCAGATGAGCGTCGGG - Intronic
1031176299 7:118356219-118356241 TTCTTTCTCAAAAGAGTGCTGGG - Intergenic
1032083908 7:128873748-128873770 ATCTTTCTCTAAGGGCTGTCGGG - Intronic
1034561806 7:151885168-151885190 ATCTTTCACCAACTGGTGTCCGG + Intergenic
1038477035 8:27875758-27875780 ATCTTTCTAAAACGAGTGCCTGG - Intronic
1040008540 8:42641564-42641586 ATCCTTCTCAGACAAGTGTCAGG - Intergenic
1042662954 8:71175928-71175950 ATCTTTCTTAAACATATGTCAGG - Intergenic
1042739450 8:72027177-72027199 ATCTTTTTCAATCAAGTGTGAGG - Intronic
1043600115 8:81927485-81927507 AGCATTCTAAAAAGAGTGTCTGG - Intergenic
1045700972 8:104865781-104865803 TTCTTTCTCAAAAAAGAGTCTGG + Intronic
1048256947 8:132912290-132912312 ATCTTTCTCCAAAGAGAGCCTGG + Intronic
1048408233 8:134144375-134144397 ATCTTTCTAAAAAGATTGTCTGG - Intergenic
1058830190 9:108809427-108809449 ACCTTTCTCACAGGGGTGTCAGG + Intergenic
1058846395 9:108963936-108963958 GTCTTTCTCAAACTGGTGTTAGG - Intronic
1059590176 9:115650446-115650468 AGCTTTCTGAAAACAGTGTCTGG + Intergenic
1060128032 9:121069073-121069095 ATCTTTCCTAGACCAGTGTCCGG - Intergenic
1061106717 9:128536401-128536423 AACTTTCTAAAACGCATGTCAGG + Exonic
1191246631 X:58233320-58233342 ATCTTTCTCATTAGAATGTCTGG - Intergenic
1195133904 X:101884177-101884199 ATCTTTCTGAAACAAGTTTTTGG + Exonic
1195133931 X:101884441-101884463 ATCTTTCTGAAACAAGTCTTTGG + Exonic
1196253647 X:113490827-113490849 ATCTTTCTCAGAGAATTGTCAGG - Intergenic
1197690486 X:129495261-129495283 ATCTTTCTTAAACGTATGTATGG + Intronic
1198955064 X:142120180-142120202 ATATATCTCAAACTAGTGTTAGG - Intergenic
1199905130 X:152219401-152219423 ATCTTTCTCAACACAATGTCAGG - Intronic