ID: 910578985

View in Genome Browser
Species Human (GRCh38)
Location 1:88800444-88800466
Sequence CTTCCTATGAAGAATCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910578985_910578987 17 Left 910578985 1:88800444-88800466 CCACAGTGATTCTTCATAGGAAG 0: 1
1: 1
2: 0
3: 16
4: 184
Right 910578987 1:88800484-88800506 AAACCCACCTTAGCAAAGATGGG No data
910578985_910578986 16 Left 910578985 1:88800444-88800466 CCACAGTGATTCTTCATAGGAAG 0: 1
1: 1
2: 0
3: 16
4: 184
Right 910578986 1:88800483-88800505 AAAACCCACCTTAGCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910578985 Original CRISPR CTTCCTATGAAGAATCACTG TGG (reversed) Intronic