ID: 910578987 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:88800484-88800506 |
Sequence | AAACCCACCTTAGCAAAGAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
910578985_910578987 | 17 | Left | 910578985 | 1:88800444-88800466 | CCACAGTGATTCTTCATAGGAAG | 0: 1 1: 1 2: 0 3: 16 4: 184 |
||
Right | 910578987 | 1:88800484-88800506 | AAACCCACCTTAGCAAAGATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
910578987 | Original CRISPR | AAACCCACCTTAGCAAAGAT GGG | Intronic | ||