ID: 910578987

View in Genome Browser
Species Human (GRCh38)
Location 1:88800484-88800506
Sequence AAACCCACCTTAGCAAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910578985_910578987 17 Left 910578985 1:88800444-88800466 CCACAGTGATTCTTCATAGGAAG 0: 1
1: 1
2: 0
3: 16
4: 184
Right 910578987 1:88800484-88800506 AAACCCACCTTAGCAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910578987 Original CRISPR AAACCCACCTTAGCAAAGAT GGG Intronic