ID: 910583004

View in Genome Browser
Species Human (GRCh38)
Location 1:88848781-88848803
Sequence CATGAGGCACAGAGGCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910583000_910583004 0 Left 910583000 1:88848758-88848780 CCACTGACAATTGGAAATATTGG No data
Right 910583004 1:88848781-88848803 CATGAGGCACAGAGGCCTCTTGG No data
910582998_910583004 22 Left 910582998 1:88848736-88848758 CCAGCAACAGGAAAAGTCAGGGC No data
Right 910583004 1:88848781-88848803 CATGAGGCACAGAGGCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910583004 Original CRISPR CATGAGGCACAGAGGCCTCT TGG Intergenic
No off target data available for this crispr